<abstract xmlns="http://www.w3.org/1999/xhtml">

<p>Potato cyst nematodes (PCNs) are the most important potato pest causing major crop losses across the world with a quarantine status in many countries. In Morocco, several potato crops are infected with PCNs and the monitoring of potato production as well as the control of import and export of potato seeds are currently carried out by morphological methods. The present work was aimed to use molecular and morphometric methods for identifying and differentiating PCN species in Morocco for the first time. The morphological identification of PCN species from collected soil samples were carried out using the shape of the cysts, the length of the stylet, the number of cuticular ridges, and the Granek’s ratio. The J2 had a slightly shorter body length, the number of cuticular ridges was 9 and the Granek’s ratio averaged 2.2. The morphobiometric analysis revealed proximity of the Moroccan population to <italic>G. pallida</italic> species. PCNs sampled from contaminated fields were analyzed molecularly using PCR. DNA amplification was performed using the multiplex PCR method and PCR-RFLP from the ITS region of the total genomic DNA compared to multiplex PCR-specific DNA sequences. All confirmed the presence <italic>G. pallida</italic> in all samples of the Moroccan PCN populations.</p>
</abstract>

Potato cyst nematodes (PCNs) are the most important potato pest causing major crop losses across the world with a quarantine status in many countries. In Morocco, several potato crops are infected with PCNs and the monitoring of potato production as well as the control of import and export of potato seeds are currently carried out by morphological methods. The present work was aimed to use molecular and morphometric methods for identifying and differentiating PCN species in Morocco for the first time. The morphological identification of PCN species from collected soil samples were carried out using the shape of the cysts, the length of the stylet, the number of cuticular ridges, and the Granek’s ratio. The J2 had a slightly shorter body length, the number of cuticular ridges was 9 and the Granek’s ratio averaged 2.2. The morphobiometric analysis revealed proximity of the Moroccan population to G. pallida species. PCNs sampled from contaminated fields were analyzed molecularly using PCR. DNA amplification was performed using the multiplex PCR method and PCR-RFLP from the ITS region of the total genomic DNA compared to multiplex PCR-specific DNA sequences. All confirmed the presence G. pallida in all samples of the Moroccan PCN populations.

<article-title xml:lang="en">First report of morphological and molecular characterization of Moroccan populations of <italic>Globodera pallida</italic>


Journal of Nematology

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

First report of morphological and molecular characterization of Moroccan populations of 


Potato cyst nematodes (PCNs) are the most important potato pest causing major crop losses across the world with a quarantine status in many countries. In...

Primer name	Nematode	5′-3′ Sequence	Band size	References
ITS5	Forward	GGAAGTAAAAGTCGTAACAAGG	–	White et al. (1990)
PITSp4	Globodera pallida	ACAACAGCAATCGTCGAG	265 bp	Bulman and Marshall (1997); Skantar et al. (2007)
PITSr3	Globodera rostochiensis	AGCGCAGACATGCCGCAA	434 bp

Species	Shape of knob	J2 stylet length (µm)	Number of cuticula ridges	Granek’s ratio
G. rostochiensisa	Rounded	(21.8)	16-31 (>14)	1.3-9.5 (>3)
G. pallida ^a	Pointed	22-24 (23.8)	8-20 (<14)	1.2-3.5 (<3)
Moroccan population G. pallida	Pointed	22.6	9	2.2

First report of morphological and molecular characterization of Moroccan populations of Globodera pallida

Publié en ligne: 01 janv. 2021

Pages: 1 - 8

DOI: https://doi.org/10.21307/jofnem-2021-007

Mots clés
Potato, Cyst nematodes, Molecular-identification, RFLP, Morocco

© 2021 Authors, published by Sciendo.

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Figure 1:

Figure 2:

Figure 3:

Primers used in the present study.

Morphological and morphometric characteristics of Moroccan population of cysts and second-stage juveniles compared to the standard Globodera pallida (EPPO, 2004).

First report of morphological and molecular characterization of Moroccan populations of Globodera pallida

Publié en ligne: 01 janv. 2021

Pages: 1 - 8

DOI: https://doi.org/10.21307/jofnem-2021-007

Mots clésPotato, Cyst nematodes, Molecular-identification, RFLP, Morocco

© 2021 Authors, published by Sciendo.

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Figure 1:

Figure 2:

Figure 3:

Primers used in the present study.

Morphological and morphometric characteristics of Moroccan population of cysts and second-stage juveniles compared to the standard Globodera pallida (EPPO, 2004).

Mots clés
Potato, Cyst nematodes, Molecular-identification, RFLP, Morocco