Accès libre

First report of morphological and molecular characterization of Moroccan populations of Globodera pallida

A. Hajjaji

A. Hajjaji

  • Research Unit Microbiology, Hygiene and Biomolecules, Laboratory of Virology, Microbiology, Quality and Biotechnology/Ecotoxicology and Biodiversity, University Hassan II of CasablancaFSTM, Morocco
  • Plant Quarantine LaboratoryBouznika, Morocco
Recherchez cet auteur sur
Sciendo|Google Scholar
Hajjaji, A.
, 
R. Ait Mhand

R. Ait Mhand

Research Unit Microbiology, Hygiene and Biomolecules, Laboratory of Virology, Microbiology, Quality and Biotechnology/Ecotoxicology and Biodiversity, University Hassan II of CasablancaFSTM, Morocco
Recherchez cet auteur sur
Sciendo|Google Scholar
Mhand, R. Ait
, 
N. Rhallabi

N. Rhallabi

Research Unit Microbiology, Hygiene and Biomolecules, Laboratory of Virology, Microbiology, Quality and Biotechnology/Ecotoxicology and Biodiversity, University Hassan II of CasablancaFSTM, Morocco
Recherchez cet auteur sur
Sciendo|Google Scholar
Rhallabi, N.
 et 
F. Mellouki

F. Mellouki

Research Unit Microbiology, Hygiene and Biomolecules, Laboratory of Virology, Microbiology, Quality and Biotechnology/Ecotoxicology and Biodiversity, University Hassan II of CasablancaFSTM, Morocco
Recherchez cet auteur sur
Sciendo|Google Scholar
Mellouki, F.
  
01 janv. 2021
First report of morphological and molecular characterization of Moroccan populations of Globodera pallida's Cover Image
À propos de cet article
Article précédent
Article suivant
Citez
Télécharger la couverture
Publié en ligne: 01 janv. 2021
Pages: 1 - 8
DOI: https://doi.org/10.21307/jofnem-2021-007
Mots clés
© 2021 Authors, published by Sciendo.
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Figure 1:

Sampled areas and regions infested with Globodera pallida in Morocco.
Sampled areas and regions infested with Globodera pallida in Morocco.

Figure 2:

Photomicrographs of morphological characterization of cyst, egg, and second-stage juvenile. A, B: Cyst of Globodera pallida, C: Vulva (v), anus (a), and cuticular ridges (r) of cyst, D, E: Stylet knob shape of J2, F: Juvenile tail.
Photomicrographs of morphological characterization of cyst, egg, and second-stage juvenile. A, B: Cyst of Globodera pallida, C: Vulva (v), anus (a), and cuticular ridges (r) of cyst, D, E: Stylet knob shape of J2, F: Juvenile tail.

Figure 3:

Amplified PCR products from Globodera spp. digested by three enzymes AluI, MboI, and RsaI. A: Amplified PCR products, B: AluI, C: RsaI, D: MboI, MW: molecular weight markers (1 kb), NC: negative control, PC: undigested DNA, S1-S2: Eastern region samples, S3-S4: Western region samples (Gharb), S5-S6: Doukkala region samples.
Amplified PCR products from Globodera spp. digested by three enzymes AluI, MboI, and RsaI. A: Amplified PCR products, B: AluI, C: RsaI, D: MboI, MW: molecular weight markers (1 kb), NC: negative control, PC: undigested DNA, S1-S2: Eastern region samples, S3-S4: Western region samples (Gharb), S5-S6: Doukkala region samples.

Primers used in the present study_

Primer name Nematode 5′-3′ Sequence Band size References
ITS5 Forward GGAAGTAAAAGTCGTAACAAGG – White et al. (1990)
PITSp4 Globodera pallida ACAACAGCAATCGTCGAG 265 bp Bulman and Marshall (1997); Skantar et al. (2007)
PITSr3 Globodera rostochiensis AGCGCAGACATGCCGCAA 434 bp

Morphological and morphometric characteristics of Moroccan population of cysts and second-stage juveniles compared to the standard Globodera pallida (EPPO, 2004)_

Species Shape of knob J2 stylet length (µm) Number of cuticula ridges Granek’s ratio
G. rostochiensisa Rounded (21.8) 16-31 (>14) 1.3-9.5 (>3)
G. pallida a Pointed 22-24 (23.8) 8-20 (<14) 1.2-3.5 (<3)
Moroccan population G. pallida Pointed 22.6 9 2.2
Langue:
Anglais
Périodicité:
1 fois par an
Sujets de la revue:
Sciences de la vie, Sciences de la vie, autres
RSS Feed de la revue