Accès libre

Characterisation of classical enterotoxins, virulence activity, and antibiotic susceptibility of Staphylococcus aureus isolated from Thai fermented pork sausages, clinical samples, and healthy carriers in northeastern Thailand

, , , , ,  et   
27 mai 2020
À propos de cet article

Citez
Télécharger la couverture

Fig. 1

PCR amplification of a S. aureus specific gene (nuc), classical SE genes (sea–see), and the tsst-1 gene. Lane M – 100 bp DNA marker; Lanes 1–7 – nuc, sea, seb, sec, sed, see, and tsst-1, respectively
PCR amplification of a S. aureus specific gene (nuc), classical SE genes (sea–see), and the tsst-1 gene. Lane M – 100 bp DNA marker; Lanes 1–7 – nuc, sea, seb, sec, sed, see, and tsst-1, respectively

Fig. 2

Production of extracellular enzymes (DNase, lipase, protease) and haemolysin by S. aureus strains isolated from three different sources. Data are presented as the mean diameter of clear zones surrounding colonies (mm), determined from triplicate independent experiments. * P < 0.05 is considered to be statistically significant in between-group comparisons
Production of extracellular enzymes (DNase, lipase, protease) and haemolysin by S. aureus strains isolated from three different sources. Data are presented as the mean diameter of clear zones surrounding colonies (mm), determined from triplicate independent experiments. * P < 0.05 is considered to be statistically significant in between-group comparisons

Fig. 3

Biofilm formation was evaluated by crystal violet staining in triplicate independent experiments. Absorbance at 570 nm was measured with a microplate reader. Isolates with OD570 values ≥0.76 were considered to be strong biofilm formers. * P < 0.05 was considered to be significantly different in between-group comparisons
Biofilm formation was evaluated by crystal violet staining in triplicate independent experiments. Absorbance at 570 nm was measured with a microplate reader. Isolates with OD570 values ≥0.76 were considered to be strong biofilm formers. * P < 0.05 was considered to be significantly different in between-group comparisons

Primer sequences used for detection of classical SE genes (sea–see) and the gene encoding toxic shock syndrome tsst-1

GenePrimer sequencesProduct size (bp)Reference
nucGCGATTGATGGTGATACGGTT279(12)
AGCCAAGCCTTGACGAACTAAAGC
seaACCGTTTCCAAAGGTACTGTA135(28)
TGGTACACCAAACAAAACAGC
sebCCTAAACCAGATGAGTTGCAC592(28)
CAGGCATCATGTCATACCAAA
secAGATGAAGTAGTTGATGTGTATGG CTTCACACTTTTAGAATCAACCG454(20)
sedGCTTGTACATATGGAGGTGTCA263(28)
GACCCATCAGAAGAATCAAACT
seeCAGTACCTATAGATAAAGTTAAAACAAGC178(10)
TAACTTACCGTGGACCCTTC
tsst-1GGCAGCATCAGCCTTATAATTT371(28)
GTGGATCCGTCATTCATTGTT

Antibiotic resistance in S_ aureus strains isolated from samples of Thai fermented pork sausage, hospitalised patients, and healthy carriers

Antibiotic groupAntibioticAntibiotic resistance in S. aureus isolates
Thai fermented pork sausages (n = 36)Hospitalised patients (n = 54)Healthy carriers (n = 10)
β-lactamspenicillin30 (83%)47 (87%)8 (80%)
ampicillin26 (72%)47 (87%)7 (70%)
amoxicillin/clavulanic acid3 (8%)1 (2%)1 (10%)
ceftriaxone0 (0%)0 (0%)0 (0%)
cephazolin0 (0%)0 (0%)0 (0%)
ceftazidime0 (0%)0 (0%)0 (0%)
cefoxitin0 (0%)0 (0%)0 (0%)
Lincosamidesclindamycin0 (0%)4 (7%)1 (10%)
Macrolideserythromycin0 (0%)4 (7%)1 (10%)
Aminoglycosidesgentamicin0 (0%)0 (0%)0 (0%)
Phenicolschloramphenicol0 (0%)2 (4%)0 (0%)
Glycopeptidesvancomycin0 (0%)0 (0%)0 (0%)
Sulphonamidestrimethoprim/sulfamethoxazole0 (0%)0 (0%)0 (0%)

Detection of classical SE and tsst-1 genes by PCR and of classical SE production by RPLA

S. aureus enterotoxin genotypeThai fermented pork sausages (n = 36)Hospitalised patients (n = 54)Healthy carriers (n = 10)
PCRRPLAPCRRPLAPCRRPLA
sea17 (47%)22 (61%)

– more frequent in Thai fermented pork sausages (P< 0.00001, compared to the hospitalised patient group)

7 (13%)4 (7%)4 (40%)6 (60%)

– more frequent in healthy carriers (P = 0.000189, compared to the hospitalised patient group)

seb4 (11%)15 (42%)18 (33%)15 (28%)1 (10%)3 (30%)
sec0 (0%)10 (28%)1 (2%)6 (11%)0 (0%)1 (10%)
sed0 (0%)0 (0%)0 (0%)0 (0%)0 (0%)0 (0%)
see1 (3%)ND1 (2%)ND0 (0%)ND
tsst-10 (0%)-0 (0%)-0 (0%)-
sea/seb2 (5%)-1 (2%)-1 (10%)-
seb/sec6 (17%)-9 (17%)-0 (0%)-
sea/seb/sec4 (11%)-2 (4%)-1 (10%)-
seb/sec/tsst-10 (0%)-4 (7%)-0 (0%)-
Total34 (94%)43 (80%)7 (70%)

Grading of biofilm formation in S_ aureus strains isolated from three different sources

OD ranges (570 nm)Biofilm quantity gradeS. aureus isolates
Thai fermented pork sausages (n = 36)Hospitalised patients (n = 54)Healthy carriers (n = 10)
<0.19Biofilm non-former0 (0%)0 (0%)0 (0%)
≥0.19 and ≤0.38Weak biofilm former0 (0%)0 (0%)0 (0%)
≥0.38 and ≤0.76Moderate biofilm former2 (6%)0 (0%)0 (0%)
≥0.76Strong biofilm former34 (94%)54 (100%)10 (100%)