Accès libre

Characterisation of classical enterotoxins, virulence activity, and antibiotic susceptibility of Staphylococcus aureus isolated from Thai fermented pork sausages, clinical samples, and healthy carriers in northeastern Thailand

Wanwisa Sankomkai
Wanwisa Sankomkai
, 
Wongwarut Boonyanugomol
Wongwarut Boonyanugomol
, 
Kairin Kraisriwattana
Kairin Kraisriwattana
, 
Julalak Nutchanon
Julalak Nutchanon
, 
Kraisorn Boonsam
Kraisorn Boonsam
, 
Sasalux Kaewbutra
Sasalux Kaewbutra
 et 
Warawan Wongboot
Warawan Wongboot
   | 27 mai 2020
Journal of Veterinary Research's Cover Image
À propos de cet article
Article précédent
Article suivant
Citez
Publié en ligne: 27 mai 2020
Pages: 289 - 297
Reçu: 25 oct. 2019
Accepté: 13 mai 2020
DOI: https://doi.org/10.2478/jvetres-2020-0036
Mots clés
© 2020 W. Sankomkai et al. published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

PCR amplification of a S. aureus specific gene (nuc), classical SE genes (sea–see), and the tsst-1 gene. Lane M – 100 bp DNA marker; Lanes 1–7 – nuc, sea, seb, sec, sed, see, and tsst-1, respectively
PCR amplification of a S. aureus specific gene (nuc), classical SE genes (sea–see), and the tsst-1 gene. Lane M – 100 bp DNA marker; Lanes 1–7 – nuc, sea, seb, sec, sed, see, and tsst-1, respectively

Fig. 2

Production of extracellular enzymes (DNase, lipase, protease) and haemolysin by S. aureus strains isolated from three different sources. Data are presented as the mean diameter of clear zones surrounding colonies (mm), determined from triplicate independent experiments. * P < 0.05 is considered to be statistically significant in between-group comparisons
Production of extracellular enzymes (DNase, lipase, protease) and haemolysin by S. aureus strains isolated from three different sources. Data are presented as the mean diameter of clear zones surrounding colonies (mm), determined from triplicate independent experiments. * P < 0.05 is considered to be statistically significant in between-group comparisons

Fig. 3

Biofilm formation was evaluated by crystal violet staining in triplicate independent experiments. Absorbance at 570 nm was measured with a microplate reader. Isolates with OD570 values ≥0.76 were considered to be strong biofilm formers. * P < 0.05 was considered to be significantly different in between-group comparisons
Biofilm formation was evaluated by crystal violet staining in triplicate independent experiments. Absorbance at 570 nm was measured with a microplate reader. Isolates with OD570 values ≥0.76 were considered to be strong biofilm formers. * P < 0.05 was considered to be significantly different in between-group comparisons

Primer sequences used for detection of classical SE genes (sea–see) and the gene encoding toxic shock syndrome tsst-1

GenePrimer sequencesProduct size (bp)Reference
nucGCGATTGATGGTGATACGGTT279(12)
AGCCAAGCCTTGACGAACTAAAGC
seaACCGTTTCCAAAGGTACTGTA135(28)
TGGTACACCAAACAAAACAGC
sebCCTAAACCAGATGAGTTGCAC592(28)
CAGGCATCATGTCATACCAAA
secAGATGAAGTAGTTGATGTGTATGG CTTCACACTTTTAGAATCAACCG454(20)
sedGCTTGTACATATGGAGGTGTCA263(28)
GACCCATCAGAAGAATCAAACT
seeCAGTACCTATAGATAAAGTTAAAACAAGC178(10)
TAACTTACCGTGGACCCTTC
tsst-1GGCAGCATCAGCCTTATAATTT371(28)
GTGGATCCGTCATTCATTGTT

Antibiotic resistance in S. aureus strains isolated from samples of Thai fermented pork sausage, hospitalised patients, and healthy carriers

Antibiotic groupAntibioticAntibiotic resistance in S. aureus isolates
Thai fermented pork sausages (n = 36)Hospitalised patients (n = 54)Healthy carriers (n = 10)
β-lactamspenicillin30 (83%)47 (87%)8 (80%)
ampicillin26 (72%)47 (87%)7 (70%)
amoxicillin/clavulanic acid3 (8%)1 (2%)1 (10%)
ceftriaxone0 (0%)0 (0%)0 (0%)
cephazolin0 (0%)0 (0%)0 (0%)
ceftazidime0 (0%)0 (0%)0 (0%)
cefoxitin0 (0%)0 (0%)0 (0%)
Lincosamidesclindamycin0 (0%)4 (7%)1 (10%)
Macrolideserythromycin0 (0%)4 (7%)1 (10%)
Aminoglycosidesgentamicin0 (0%)0 (0%)0 (0%)
Phenicolschloramphenicol0 (0%)2 (4%)0 (0%)
Glycopeptidesvancomycin0 (0%)0 (0%)0 (0%)
Sulphonamidestrimethoprim/sulfamethoxazole0 (0%)0 (0%)0 (0%)

Detection of classical SE and tsst-1 genes by PCR and of classical SE production by RPLA

S. aureus enterotoxin genotypeThai fermented pork sausages (n = 36)Hospitalised patients (n = 54)Healthy carriers (n = 10)
PCRRPLAPCRRPLAPCRRPLA
sea17 (47%)22 (61%)

– more frequent in Thai fermented pork sausages (P< 0.00001, compared to the hospitalised patient group)

7 (13%)4 (7%)4 (40%)6 (60%)

– more frequent in healthy carriers (P = 0.000189, compared to the hospitalised patient group)

seb4 (11%)15 (42%)18 (33%)15 (28%)1 (10%)3 (30%)
sec0 (0%)10 (28%)1 (2%)6 (11%)0 (0%)1 (10%)
sed0 (0%)0 (0%)0 (0%)0 (0%)0 (0%)0 (0%)
see1 (3%)ND1 (2%)ND0 (0%)ND
tsst-10 (0%)-0 (0%)-0 (0%)-
sea/seb2 (5%)-1 (2%)-1 (10%)-
seb/sec6 (17%)-9 (17%)-0 (0%)-
sea/seb/sec4 (11%)-2 (4%)-1 (10%)-
seb/sec/tsst-10 (0%)-4 (7%)-0 (0%)-
Total34 (94%)43 (80%)7 (70%)

Grading of biofilm formation in S. aureus strains isolated from three different sources

OD ranges (570 nm)Biofilm quantity gradeS. aureus isolates
Thai fermented pork sausages (n = 36)Hospitalised patients (n = 54)Healthy carriers (n = 10)
<0.19Biofilm non-former0 (0%)0 (0%)0 (0%)
≥0.19 and ≤0.38Weak biofilm former0 (0%)0 (0%)0 (0%)
≥0.38 and ≤0.76Moderate biofilm former2 (6%)0 (0%)0 (0%)
≥0.76Strong biofilm former34 (94%)54 (100%)10 (100%)
eISSN:
2450-8608
Langue:
Anglais
Périodicité:
4 fois par an
Sujets de la revue:
Life Sciences, Molecular Biology, Microbiology and Virology, other, Medicine, Veterinary Medicine
RSS Feed de la revue