Uneingeschränkter Zugang

Characterisation of classical enterotoxins, virulence activity, and antibiotic susceptibility of Staphylococcus aureus isolated from Thai fermented pork sausages, clinical samples, and healthy carriers in northeastern Thailand

Wanwisa Sankomkai

Wanwisa Sankomkai

Unit of Water and Food Analysis, Division of ResearchAmnatcharoen, Thailand
Suche nach diesem Autor auf
Sciendo|Google Scholar
Sankomkai, Wanwisa
, 
Wongwarut Boonyanugomol

Wongwarut Boonyanugomol

  • Unit of Water and Food Analysis, Division of ResearchAmnatcharoen, Thailand
  • Department of Sciences and Liberal Arts, Mahidol University, Amnatcharoen CampusAmnatcharoen, Thailand
Suche nach diesem Autor auf
Sciendo|Google Scholar
Boonyanugomol, Wongwarut
, 
Kairin Kraisriwattana

Kairin Kraisriwattana

Unit of Water and Food Analysis, Division of ResearchAmnatcharoen, Thailand
Suche nach diesem Autor auf
Sciendo|Google Scholar
Kraisriwattana, Kairin
, 
Julalak Nutchanon

Julalak Nutchanon

Unit of Water and Food Analysis, Division of ResearchAmnatcharoen, Thailand
Suche nach diesem Autor auf
Sciendo|Google Scholar
Nutchanon, Julalak
, 
Kraisorn Boonsam

Kraisorn Boonsam

Microbiology Laboratory, Division of Clinical Pathology, Amnatcharoen HospitalAmnatcharoen, Thailand
Suche nach diesem Autor auf
Sciendo|Google Scholar
Boonsam, Kraisorn
, 
Sasalux Kaewbutra

Sasalux Kaewbutra

  • Unit of Water and Food Analysis, Division of ResearchAmnatcharoen, Thailand
  • Department of Sciences and Liberal Arts, Mahidol University, Amnatcharoen CampusAmnatcharoen, Thailand
Suche nach diesem Autor auf
Sciendo|Google Scholar
Kaewbutra, Sasalux
 und 
Warawan Wongboot

Warawan Wongboot

National Institute of Health, Department of Medical Sciences, Ministry of Public HealthNonthaburi, Thailand
Suche nach diesem Autor auf
Sciendo|Google Scholar
Wongboot, Warawan
  
27. Mai 2020
Characterisation of classical enterotoxins, virulence activity, and antibiotic susceptibility of Staphylococcus aureus isolated from Thai fermented pork sausages, clinical samples, and healthy carriers in northeastern Thailand's Cover Image
Über diesen Artikel
Vorheriger Artikel
Nächster Artikel
Zitieren
COVER HERUNTERLADEN
Online veröffentlicht: 27. Mai 2020
Seitenbereich: 289 - 297
Eingereicht: 25. Okt. 2019
Akzeptiert: 13. Mai 2020
DOI: https://doi.org/10.2478/jvetres-2020-0036
Schlüsselwörter
© 2020 W. Sankomkai et al. published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

PCR amplification of a S. aureus specific gene (nuc), classical SE genes (sea–see), and the tsst-1 gene. Lane M – 100 bp DNA marker; Lanes 1–7 – nuc, sea, seb, sec, sed, see, and tsst-1, respectively
PCR amplification of a S. aureus specific gene (nuc), classical SE genes (sea–see), and the tsst-1 gene. Lane M – 100 bp DNA marker; Lanes 1–7 – nuc, sea, seb, sec, sed, see, and tsst-1, respectively

Fig. 2

Production of extracellular enzymes (DNase, lipase, protease) and haemolysin by S. aureus strains isolated from three different sources. Data are presented as the mean diameter of clear zones surrounding colonies (mm), determined from triplicate independent experiments. * P < 0.05 is considered to be statistically significant in between-group comparisons
Production of extracellular enzymes (DNase, lipase, protease) and haemolysin by S. aureus strains isolated from three different sources. Data are presented as the mean diameter of clear zones surrounding colonies (mm), determined from triplicate independent experiments. * P < 0.05 is considered to be statistically significant in between-group comparisons

Fig. 3

Biofilm formation was evaluated by crystal violet staining in triplicate independent experiments. Absorbance at 570 nm was measured with a microplate reader. Isolates with OD570 values ≥0.76 were considered to be strong biofilm formers. * P < 0.05 was considered to be significantly different in between-group comparisons
Biofilm formation was evaluated by crystal violet staining in triplicate independent experiments. Absorbance at 570 nm was measured with a microplate reader. Isolates with OD570 values ≥0.76 were considered to be strong biofilm formers. * P < 0.05 was considered to be significantly different in between-group comparisons

Primer sequences used for detection of classical SE genes (sea–see) and the gene encoding toxic shock syndrome tsst-1

GenePrimer sequencesProduct size (bp)Reference
nucGCGATTGATGGTGATACGGTT279(12)
AGCCAAGCCTTGACGAACTAAAGC
seaACCGTTTCCAAAGGTACTGTA135(28)
TGGTACACCAAACAAAACAGC
sebCCTAAACCAGATGAGTTGCAC592(28)
CAGGCATCATGTCATACCAAA
secAGATGAAGTAGTTGATGTGTATGG CTTCACACTTTTAGAATCAACCG454(20)
sedGCTTGTACATATGGAGGTGTCA263(28)
GACCCATCAGAAGAATCAAACT
seeCAGTACCTATAGATAAAGTTAAAACAAGC178(10)
TAACTTACCGTGGACCCTTC
tsst-1GGCAGCATCAGCCTTATAATTT371(28)
GTGGATCCGTCATTCATTGTT

Antibiotic resistance in S_ aureus strains isolated from samples of Thai fermented pork sausage, hospitalised patients, and healthy carriers

Antibiotic groupAntibioticAntibiotic resistance in S. aureus isolates
Thai fermented pork sausages (n = 36)Hospitalised patients (n = 54)Healthy carriers (n = 10)
β-lactamspenicillin30 (83%)47 (87%)8 (80%)
ampicillin26 (72%)47 (87%)7 (70%)
amoxicillin/clavulanic acid3 (8%)1 (2%)1 (10%)
ceftriaxone0 (0%)0 (0%)0 (0%)
cephazolin0 (0%)0 (0%)0 (0%)
ceftazidime0 (0%)0 (0%)0 (0%)
cefoxitin0 (0%)0 (0%)0 (0%)
Lincosamidesclindamycin0 (0%)4 (7%)1 (10%)
Macrolideserythromycin0 (0%)4 (7%)1 (10%)
Aminoglycosidesgentamicin0 (0%)0 (0%)0 (0%)
Phenicolschloramphenicol0 (0%)2 (4%)0 (0%)
Glycopeptidesvancomycin0 (0%)0 (0%)0 (0%)
Sulphonamidestrimethoprim/sulfamethoxazole0 (0%)0 (0%)0 (0%)

Detection of classical SE and tsst-1 genes by PCR and of classical SE production by RPLA

S. aureus enterotoxin genotypeThai fermented pork sausages (n = 36)Hospitalised patients (n = 54)Healthy carriers (n = 10)
PCRRPLAPCRRPLAPCRRPLA
sea17 (47%)22 (61%)

– more frequent in Thai fermented pork sausages (P< 0.00001, compared to the hospitalised patient group)

7 (13%)4 (7%)4 (40%)6 (60%)

– more frequent in healthy carriers (P = 0.000189, compared to the hospitalised patient group)

seb4 (11%)15 (42%)18 (33%)15 (28%)1 (10%)3 (30%)
sec0 (0%)10 (28%)1 (2%)6 (11%)0 (0%)1 (10%)
sed0 (0%)0 (0%)0 (0%)0 (0%)0 (0%)0 (0%)
see1 (3%)ND1 (2%)ND0 (0%)ND
tsst-10 (0%)-0 (0%)-0 (0%)-
sea/seb2 (5%)-1 (2%)-1 (10%)-
seb/sec6 (17%)-9 (17%)-0 (0%)-
sea/seb/sec4 (11%)-2 (4%)-1 (10%)-
seb/sec/tsst-10 (0%)-4 (7%)-0 (0%)-
Total34 (94%)43 (80%)7 (70%)

Grading of biofilm formation in S_ aureus strains isolated from three different sources

OD ranges (570 nm)Biofilm quantity gradeS. aureus isolates
Thai fermented pork sausages (n = 36)Hospitalised patients (n = 54)Healthy carriers (n = 10)
<0.19Biofilm non-former0 (0%)0 (0%)0 (0%)
≥0.19 and ≤0.38Weak biofilm former0 (0%)0 (0%)0 (0%)
≥0.38 and ≤0.76Moderate biofilm former2 (6%)0 (0%)0 (0%)
≥0.76Strong biofilm former34 (94%)54 (100%)10 (100%)
Sprache:
Englisch
Zeitrahmen der Veröffentlichung:
4 Hefte pro Jahr
Fachgebiete der Zeitschrift:
Biologie, Molekularbiologie, Mikrobiologie und Virologie, Biologie, andere, Medizin, Veterinärmedizin
Zeitschrift RSS Feed