Accès libre

Expression of genes involved in the inflammatory response in human granulosa cells in short-term in vitro culture

Sandra Kałużna

Sandra Kałużna

Department of Histology and Embryology, Poznań University of Medical SciencesPoznań, Poland
Recherchez cet auteur sur
Sciendo|Google Scholar
Kałużna, Sandra
, 
Rut Bryl

Rut Bryl

Division of Infertility and Reproductive Endocrinology, Department of Gynecology, Obstetrics and Gynecological Oncology, Poznań University of Medical SciencesPoznań, Poland
Recherchez cet auteur sur
Sciendo|Google Scholar
Bryl, Rut
, 
Błażej Chermuła

Błażej Chermuła

Division of Infertility and Reproductive Endocrinology, Department of Gynecology, Obstetrics and Gynecological Oncology, Poznań University of Medical SciencesPoznań, Poland
Recherchez cet auteur sur
Sciendo|Google Scholar
Chermuła, Błażej
, 
Rafał Sibiak

Rafał Sibiak

Department of Histology and Embryology, Poznań University of Medical SciencesPoznań, Poland
Recherchez cet auteur sur
Sciendo|Google Scholar
Sibiak, Rafał
, 
Katarzyna Stefańska

Katarzyna Stefańska

Department of Histology and Embryology, Poznań University of Medical SciencesPoznań, Poland
Recherchez cet auteur sur
Sciendo|Google Scholar
Stefańska, Katarzyna
, 
Wojciech Pieńkowski

Wojciech Pieńkowski

Division of Perinatology and Women’s Diseases, Poznań University of Medical SciencesPoznań, Poland
Recherchez cet auteur sur
Sciendo|Google Scholar
Pieńkowski, Wojciech
, 
Wiesława Kranc

Wiesława Kranc

Department of Anatomy, Poznań University of Medical SciencesPoznań, Poland
Recherchez cet auteur sur
Sciendo|Google Scholar
Kranc, Wiesława
, 
Michal Jeseta

Michal Jeseta

Department of Obstetrics and Gynecology, University Hospital and Masaryk UniversityBrno, Czech Republic
Recherchez cet auteur sur
Sciendo|Google Scholar
Jeseta, Michal
, 
Pavel Ventruba

Pavel Ventruba

Department of Obstetrics and Gynecology, University Hospital and Masaryk UniversityBrno, Czech Republic
Recherchez cet auteur sur
Sciendo|Google Scholar
Ventruba, Pavel
, 
Jana Zakova

Jana Zakova

Department of Obstetrics and Gynecology, University Hospital and Masaryk UniversityBrno, Czech Republic
Recherchez cet auteur sur
Sciendo|Google Scholar
Zakova, Jana
, 
Igor Crha

Igor Crha

Department of Obstetrics and Gynecology, University Hospital and Masaryk UniversityBrno, Czech Republic
Recherchez cet auteur sur
Sciendo|Google Scholar
Crha, Igor
, 
Leszek Pawelczyk

Leszek Pawelczyk

Division of Infertility and Reproductive Endocrinology, Department of Gynecology, Obstetrics and Gynecological Oncology, Poznań University of Medical SciencesPoznań, Poland
Recherchez cet auteur sur
Sciendo|Google Scholar
Pawelczyk, Leszek
 et 
Robert Z. Spaczyński

Robert Z. Spaczyński

Division of Infertility and Reproductive Endocrinology, Department of Gynecology, Obstetrics and Gynecological Oncology, Poznań University of Medical SciencesPoznań, Poland
Recherchez cet auteur sur
Sciendo|Google Scholar
Spaczyński, Robert Z.
  
31 déc. 2020
Expression of genes involved in the inflammatory response in human granulosa cells in short-term in vitro culture's Cover Image
À propos de cet article
Article précédent
Article suivant
Citez
Télécharger la couverture
Publié en ligne: 31 déc. 2020
Pages: 190 - 195
Reçu: 18 nov. 2020
Accepté: 21 déc. 2020
DOI: https://doi.org/10.2478/acb-2020-0025
Mots clés
© 2020 Sandra Kałużna, Rut Bryl, Błażej Chermuła, Rafał Sibiak, Katarzyna Stefańska, Wojciech Pieńkowski, Wiesława Kranc, Michal Jeseta, Pavel Ventruba, Jana Zakova, Igor Crha, Leszek Pawelczyk, Robert Z. Spaczyński, published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Figure 1

The change in the expression of IL1B, IL6 and TNFa genes in 48h and 72h in short-term in vitro culture of human ovarian granulosa cells, as compared to the expression in 24 hours of culture
The change in the expression of IL1B, IL6 and TNFa genes in 48h and 72h in short-term in vitro culture of human ovarian granulosa cells, as compared to the expression in 24 hours of culture

Oligonucleotide sequences of primers used for RT-qPCR analysis

GENEPRIMER SEQUENCE (5’–3’)PRODUCT SIZE (BP)
IL1βF GGGCCTCAAGGAAAAGAATCR TTCTGCTTGAGAGGTGCTGA205
IL6F ACAACCTGAACCTTCCAAAGAR ACAACCTGAACCTTCCAAAGA179
TNFαF AGCCCATGTTGTAGCAAACCR AGCCCATGTTGTAGCAAACC157
ACTBF AAAGACCTGTACGCCAACACR CTCAGGAGGAGCAATGATCTTG132
GAPDHF TCAGCCGCATCTTCTTTTGCR ACGACCAAATCCGTTGACTC90
HPRTF TGGCGTCGTGATTAGTGATGR ACATCTCGAGCAAGACGTTC141
Langue:
Anglais
Périodicité:
4 fois par an
Sujets de la revue:
Sciences de la vie, Biologie moléculaire, Biochimie
RSS Feed de la revue