Acceso abierto

Expression of genes involved in the inflammatory response in human granulosa cells in short-term in vitro culture

Sandra Kałużna

Sandra Kałużna

Department of Histology and Embryology, Poznań University of Medical SciencesPoznań, Poland
Buscar este autor en
Sciendo|Google Scholar
Kałużna, Sandra
, 
Rut Bryl

Rut Bryl

Division of Infertility and Reproductive Endocrinology, Department of Gynecology, Obstetrics and Gynecological Oncology, Poznań University of Medical SciencesPoznań, Poland
Buscar este autor en
Sciendo|Google Scholar
Bryl, Rut
, 
Błażej Chermuła

Błażej Chermuła

Division of Infertility and Reproductive Endocrinology, Department of Gynecology, Obstetrics and Gynecological Oncology, Poznań University of Medical SciencesPoznań, Poland
Buscar este autor en
Sciendo|Google Scholar
Chermuła, Błażej
, 
Rafał Sibiak

Rafał Sibiak

Department of Histology and Embryology, Poznań University of Medical SciencesPoznań, Poland
Buscar este autor en
Sciendo|Google Scholar
Sibiak, Rafał
, 
Katarzyna Stefańska

Katarzyna Stefańska

Department of Histology and Embryology, Poznań University of Medical SciencesPoznań, Poland
Buscar este autor en
Sciendo|Google Scholar
Stefańska, Katarzyna
, 
Wojciech Pieńkowski

Wojciech Pieńkowski

Division of Perinatology and Women’s Diseases, Poznań University of Medical SciencesPoznań, Poland
Buscar este autor en
Sciendo|Google Scholar
Pieńkowski, Wojciech
, 
Wiesława Kranc

Wiesława Kranc

Department of Anatomy, Poznań University of Medical SciencesPoznań, Poland
Buscar este autor en
Sciendo|Google Scholar
Kranc, Wiesława
, 
Michal Jeseta

Michal Jeseta

Department of Obstetrics and Gynecology, University Hospital and Masaryk UniversityBrno, Czech Republic
Buscar este autor en
Sciendo|Google Scholar
Jeseta, Michal
, 
Pavel Ventruba

Pavel Ventruba

Department of Obstetrics and Gynecology, University Hospital and Masaryk UniversityBrno, Czech Republic
Buscar este autor en
Sciendo|Google Scholar
Ventruba, Pavel
, 
Jana Zakova

Jana Zakova

Department of Obstetrics and Gynecology, University Hospital and Masaryk UniversityBrno, Czech Republic
Buscar este autor en
Sciendo|Google Scholar
Zakova, Jana
, 
Igor Crha

Igor Crha

Department of Obstetrics and Gynecology, University Hospital and Masaryk UniversityBrno, Czech Republic
Buscar este autor en
Sciendo|Google Scholar
Crha, Igor
, 
Leszek Pawelczyk

Leszek Pawelczyk

Division of Infertility and Reproductive Endocrinology, Department of Gynecology, Obstetrics and Gynecological Oncology, Poznań University of Medical SciencesPoznań, Poland
Buscar este autor en
Sciendo|Google Scholar
Pawelczyk, Leszek
 y 
Robert Z. Spaczyński

Robert Z. Spaczyński

Division of Infertility and Reproductive Endocrinology, Department of Gynecology, Obstetrics and Gynecological Oncology, Poznań University of Medical SciencesPoznań, Poland
Buscar este autor en
Sciendo|Google Scholar
Spaczyński, Robert Z.
  
31 dic 2020
Expression of genes involved in the inflammatory response in human granulosa cells in short-term in vitro culture's Cover Image
Acerca de este artículo
Artículo anterior
Artículo siguiente
Cite
Descargar portada
Publicado en línea: 31 dic 2020
Páginas: 190 - 195
Recibido: 18 nov 2020
Aceptado: 21 dic 2020
DOI: https://doi.org/10.2478/acb-2020-0025
Palabras clave
© 2020 Sandra Kałużna, Rut Bryl, Błażej Chermuła, Rafał Sibiak, Katarzyna Stefańska, Wojciech Pieńkowski, Wiesława Kranc, Michal Jeseta, Pavel Ventruba, Jana Zakova, Igor Crha, Leszek Pawelczyk, Robert Z. Spaczyński, published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Figure 1

The change in the expression of IL1B, IL6 and TNFa genes in 48h and 72h in short-term in vitro culture of human ovarian granulosa cells, as compared to the expression in 24 hours of culture
The change in the expression of IL1B, IL6 and TNFa genes in 48h and 72h in short-term in vitro culture of human ovarian granulosa cells, as compared to the expression in 24 hours of culture

Oligonucleotide sequences of primers used for RT-qPCR analysis

GENEPRIMER SEQUENCE (5’–3’)PRODUCT SIZE (BP)
IL1βF GGGCCTCAAGGAAAAGAATCR TTCTGCTTGAGAGGTGCTGA205
IL6F ACAACCTGAACCTTCCAAAGAR ACAACCTGAACCTTCCAAAGA179
TNFαF AGCCCATGTTGTAGCAAACCR AGCCCATGTTGTAGCAAACC157
ACTBF AAAGACCTGTACGCCAACACR CTCAGGAGGAGCAATGATCTTG132
GAPDHF TCAGCCGCATCTTCTTTTGCR ACGACCAAATCCGTTGACTC90
HPRTF TGGCGTCGTGATTAGTGATGR ACATCTCGAGCAAGACGTTC141
Idioma:
Inglés
Calendario de la edición:
4 veces al año
Temas de la revista:
Ciencias de la vida, Biología molecular, Bioquímica
RSS Feed de revista