<abstract xmlns="http://www.w3.org/1999/xhtml">The essential function of granulosa cells is to maintain the proper course of oogenesis and folliculogenesis.The immune system is an additional local regulator of ovarian function, with cytokines necessary for the proper function of the ovaries, including the secretion of steroid hormonesThis study aimed to analyze the expression of genes in human GCs in short-term primary culture and define the difference in the expression of <italic>IL1β</italic>, <italic>IL6</italic>, and <italic>TNFα</italic> genes at 48h and 72h of culture compared to the 24h control. Total RNA was isolated using the Chomczyński and Sacchi protocol. RNA samples were treated with DNase I and reverse transcribed (RT) into cDNA. The determination of transcript levels of the mentioned genes was performed using the Light Cycler® 96 Real-Time PCR kit, Roche Diagnostics GmbH (Mannheim, Germany).The present study proved that granulosa cells in a short-term primary <italic>in vitro</italic> culture express <italic>IL-1β, IL-6</italic>, and <italic>TNFα</italic>. The tested genes show a decrease in expression at 24h of culture and a subsequent slight increase at 72h, not exceeding the initial levels. The expression changes the most for IL1β and the least for TNFα.The fluctuations in the amount of transcript may be influenced by factors stored in granulosa cells before the IVM procedure, the procedure of <italic>in vitro</italic> fertilization, as well as factors related to the process of primary culture. More research is needed to understand the details of these occurrences.<bold>Running title</bold>: The inflammatory response in human granulosa cells</abstract>

The essential function of granulosa cells is to maintain the proper course of oogenesis and folliculogenesis.The immune system is an additional local regulator of ovarian function, with cytokines necessary for the proper function of the ovaries, including the secretion of steroid hormonesThis study aimed to analyze the expression of genes in human GCs in short-term primary culture and define the difference in the expression of IL1β, IL6, and TNFα genes at 48h and 72h of culture compared to the 24h control. Total RNA was isolated using the Chomczyński and Sacchi protocol. RNA samples were treated with DNase I and reverse transcribed (RT) into cDNA. The determination of transcript levels of the mentioned genes was performed using the Light Cycler® 96 Real-Time PCR kit, Roche Diagnostics GmbH (Mannheim, Germany).The present study proved that granulosa cells in a short-term primary in vitro culture express IL-1β, IL-6, and TNFα. The tested genes show a decrease in expression at 24h of culture and a subsequent slight increase at 72h, not exceeding the initial levels. The expression changes the most for IL1β and the least for TNFα.The fluctuations in the amount of transcript may be influenced by factors stored in granulosa cells before the IVM procedure, the procedure of in vitro fertilization, as well as factors related to the process of primary culture. More research is needed to understand the details of these occurrences.Running title: The inflammatory response in human granulosa cells

Expression of genes involved in the inflammatory response in human granulosa cells in short-term in vitro culture

Medical Journal of Cell Biology

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

The essential function of granulosa cells is to maintain the proper course of oogenesis and folliculogenesis.The immune system is an additional local regulator...

GENE	PRIMER SEQUENCE (5’–3’)	PRODUCT SIZE (BP)
IL1β	F GGGCCTCAAGGAAAAGAATCR TTCTGCTTGAGAGGTGCTGA	205
IL6	F ACAACCTGAACCTTCCAAAGAR ACAACCTGAACCTTCCAAAGA	179
TNFα	F AGCCCATGTTGTAGCAAACCR AGCCCATGTTGTAGCAAACC	157
ACTB	F AAAGACCTGTACGCCAACACR CTCAGGAGGAGCAATGATCTTG	132
GAPDH	F TCAGCCGCATCTTCTTTTGCR ACGACCAAATCCGTTGACTC	90
HPRT	F TGGCGTCGTGATTAGTGATGR ACATCTCGAGCAAGACGTTC	141

Expression of genes involved in the inflammatory response in human granulosa cells in short-term in vitro culture

Publicado en línea: 31 dic 2020

Páginas: 190 - 195

Recibido: 18 nov 2020

Aceptado: 21 dic 2020

DOI: https://doi.org/10.2478/acb-2020-0025

Palabras clave
granulosa cells (GCs), IL1β, IL6, i TNFα

© 2020 Sandra Kałużna, Rut Bryl, Błażej Chermuła, Rafał Sibiak, Katarzyna Stefańska, Wojciech Pieńkowski, Wiesława Kranc, Michal Jeseta, Pavel Ventruba, Jana Zakova, Igor Crha, Leszek Pawelczyk, Robert Z. Spaczyński, published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Figure 1

Oligonucleotide sequences of primers used for RT-qPCR analysis

Expression of genes involved in the inflammatory response in human granulosa cells in short-term in vitro culture

Publicado en línea: 31 dic 2020

Páginas: 190 - 195

Recibido: 18 nov 2020

Aceptado: 21 dic 2020

DOI: https://doi.org/10.2478/acb-2020-0025

Palabras clavegranulosa cells (GCs), IL1β, IL6, i TNFα

© 2020 Sandra Kałużna, Rut Bryl, Błażej Chermuła, Rafał Sibiak, Katarzyna Stefańska, Wojciech Pieńkowski, Wiesława Kranc, Michal Jeseta, Pavel Ventruba, Jana Zakova, Igor Crha, Leszek Pawelczyk, Robert Z. Spaczyński, published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Figure 1

Oligonucleotide sequences of primers used for RT-qPCR analysis

Palabras clave
granulosa cells (GCs), IL1β, IL6, i TNFα