Acceso abierto

Comparative Transcriptome Analysis Reveals the Molecular Mechanisms of Acetic Acid Reduction by Adding NaHSO3 in Actinobacillus succinogenes GXAS137

Shiyong Li
Shiyong Li
, 
Chaodong Song
Chaodong Song
, 
Hongyan Zhang
Hongyan Zhang
, 
Yan Qin
Yan Qin
, 
Mingguo Jiang
Mingguo Jiang
 y 
Naikun Shen
Naikun Shen
   | 16 dic 2023
Polish Journal of Microbiology's Cover Image
Acerca de este artículo
Artículo anterior
Artículo siguiente
Cite
Article Category: ORIGINAL PAPER
Publicado en línea: 16 dic 2023
Páginas: 399 - 411
Recibido: 23 jul 2023
Aceptado: 28 ago 2023
DOI: https://doi.org/10.33073/pjm-2023-036
Palabras clave
© 2023 Shiyong Li et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1.

Analysis of fermentation products. A) The comparison of metabolites was determined by HPLC in the experimental group (EG) and control check (CK); 1 – pyruvic acid, 2 – lactic acid, 3 – acetic acid, 4 – pyruvate dimer, 5 – unknown, 6 – citric acid, 7 – succinic acid B) The concentration of organic acid and biomass of EG and CK. Each value is the mean for three replicates, with vertical bars indicating standard errors. The lower-case letters at each time point indicate a significant difference at p ≤ 0.05 by Duncans multiple range tests.
Analysis of fermentation products. A) The comparison of metabolites was determined by HPLC in the experimental group (EG) and control check (CK); 1 – pyruvic acid, 2 – lactic acid, 3 – acetic acid, 4 – pyruvate dimer, 5 – unknown, 6 – citric acid, 7 – succinic acid B) The concentration of organic acid and biomass of EG and CK. Each value is the mean for three replicates, with vertical bars indicating standard errors. The lower-case letters at each time point indicate a significant difference at p ≤ 0.05 by Duncans multiple range tests.

Fig. 2.

Scatter plot of Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment for DEGs between CK and EG. Rich factor refers to the ratio of the number of genes annotated to the pathway in the DEGs to the total number of genes located at the pathway among all annotated.
Scatter plot of Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment for DEGs between CK and EG. Rich factor refers to the ratio of the number of genes annotated to the pathway in the DEGs to the total number of genes located at the pathway among all annotated.

Fig. 3.

Relative expression levels of 12 DEGs when a reference gene 16S rDNA was used for normalization. Different lowercase letters in the table show significant differences (p < 0.05).
Relative expression levels of 12 DEGs when a reference gene 16S rDNA was used for normalization. Different lowercase letters in the table show significant differences (p < 0.05).

Fig. 4.

Metabolism map of the central metabolic pathway of A. succinogenes, the green arrow represents the C3 pathway. All green arrows represent the C3 pathway, and the green dotted line represents pathway disruption. Metabolites: G-6-P – glucose-6-phosphate, F-6-P – fructose-6-phosphate, G-3-P – glyceraldehyde-3-phosphate, Glycerate-3-P – glycerate-3-phosphate, Glycerate-2-P – glycerate-2-phosphate, PEP – phosphoenolpyruvate, OAA – oxaloacetic acid, Mal – malic acid, Fum – fumaric acid, SA – succinic acid, Pyr – pyruvic acid, For – formic acid, AcCOA – acetyl-COA, AcP – acetylphosphate, AC – acetic acid, AcAld – acetaldehyde, EtOH – ethanol, BAC – bisulfite-acetaldehyde complex Enzymes: PGAM – phosphoglycerate mutase, ENO – enolase, PEPCK – PEP carboxykinase, ASPC – aspartate aminotransferase, MDH – malate dehydrogenase, FM – fumarase, FRD – fumarate reductase, OAD – oxaloacetate decarboxylase, PK – pyruvate kinase, PDH – pyruvate dehydrogenase, PFL – pyruvate formate-lyase, FDH – formate dehydrogenase, PTA – phosphate acetyltransferase, ACK – acetate kinase, ADHE – acetaldehyde-alcohol dehydrogenase. LipB – lipoyl-transferase, LipA – lipoyl-synthase
Metabolism map of the central metabolic pathway of A. succinogenes, the green arrow represents the C3 pathway. All green arrows represent the C3 pathway, and the green dotted line represents pathway disruption. Metabolites: G-6-P – glucose-6-phosphate, F-6-P – fructose-6-phosphate, G-3-P – glyceraldehyde-3-phosphate, Glycerate-3-P – glycerate-3-phosphate, Glycerate-2-P – glycerate-2-phosphate, PEP – phosphoenolpyruvate, OAA – oxaloacetic acid, Mal – malic acid, Fum – fumaric acid, SA – succinic acid, Pyr – pyruvic acid, For – formic acid, AcCOA – acetyl-COA, AcP – acetylphosphate, AC – acetic acid, AcAld – acetaldehyde, EtOH – ethanol, BAC – bisulfite-acetaldehyde complex Enzymes: PGAM – phosphoglycerate mutase, ENO – enolase, PEPCK – PEP carboxykinase, ASPC – aspartate aminotransferase, MDH – malate dehydrogenase, FM – fumarase, FRD – fumarate reductase, OAD – oxaloacetate decarboxylase, PK – pyruvate kinase, PDH – pyruvate dehydrogenase, PFL – pyruvate formate-lyase, FDH – formate dehydrogenase, PTA – phosphate acetyltransferase, ACK – acetate kinase, ADHE – acetaldehyde-alcohol dehydrogenase. LipB – lipoyl-transferase, LipA – lipoyl-synthase

Primer sequences of differentially expressed genes in Actimobacillus succinogenes for qRT-PCR analysis.

Gene ID Function Primer sequence (5’ to 3’) Product size (bp)
CBG46_04720 short-chain dehydrogenase F: GCTAACCAAATCGCTGGCTA 173
R: GTAACTCTTCCGGTTTGCCT
CBG46_04260 phosphoenolpyruvate carboxykinase F: TCGAACGCATGAAAGCCTC 188
R: ACCCGGTAATGCTTTAGGAA
CBG46_02425 bisphosphoglycerate-dependent phosphoglycerate mutase F: TAAACCTTTTCACCGGCTGGA 183
R: GCACCCATAATTGGTCGGAT
CBG46_04200 phosphogluconate dehydrogenase (NADP+-dependent decarboxylating) F: GCATCCGAGCAATTCGACT 187
R: GCCAATCCGCCATAGCATT
CBG46_04725 ATPase F: TATCACTACATTGGCGGGCTA 181
R: AATTTGATTCAGCGTCCAGT
CBG46_02335 bifunctional acetaldehyde-alcohol dehydrogenase F: CCAACACGGCACATTAGCAT 191
R: ATATCACGCCAACCGGATCG
CBG46_03325 L-threonine dehydrogenase F: ATCGAAGCCTACGTATCCAC 197
R: ATCGCATGAACATAGCCGAGA
CBG46_08215 ribose 5-phosphate isomerase B F: GAGCGTGGAATTCTTACCTG 160
R: CAATCACACGCTCACCGAA
CBG46_05965 2-deoxyribose-5-phosphate aldolase F: CTGCCGCGATTTAAACGTC 174
R: GCACCGGCATTAATCATTGCT
CBG46_07640 sulfate ABC transporter substrate-binding protein F: ATAGCAAGATTAACGGCACCC 174
R: ACTTTTCATTCACGTCGAAGG
CBG46_00190 sulfurtransferase TusE F: CAACAACAGATTGAAACCGA 170
R: CCGGCGAAGTTTTGTATTCCT
CBG46_00510 pyruvate dehydrogenase F: CAATCTTACGCCATGTTCGTG 191
R: CGGCTTATCGGACATCACT
16S rDNA reference genes F: ACTGGAACTGAGACACGGT 187
R: GCTTCTTCTGTGGCTAACGTC

The quality control data statistic table after filtering.

Sample Sample description Total reads Bases (bp) Q20 (%) Q30 (%) Uniq mapped reads
CK_1 Control replication 1 31,227,958 4,230,512,865 98.43 95.28 30,230,330 (96.81%)
CK_2 Control replication 2 29,665,406 4,045,453,270 98.33 95.01 28,618,805 (96.47%)
CK_3 Control replication 3 33,864,286 4,615,803,043 98.36 95.08 32,895,101 (97.14%)
EG_1 NaHSO3 treatment replication 1 35,209,904 4,761,438,256 98.37 95.10 33,873,034 (96.2%)
EG_2 NaHSO3 treatment replication 2 32,640,396 4,435,226,539 98.4 95.16 31,262,811 (95.78%)
EG_3 NaHSO3 treatment replication 3 35,564,774 4,849,551,152 98.33 95.00 34,078,998 (95.82%)
eISSN:
2544-4646
Idioma:
Inglés
Calendario de la edición:
4 veces al año
Temas de la revista:
Life Sciences, Microbiology and Virology
RSS Feed de revista