Acceso abierto

Whole genome sequencing and analysis of a goose-derived Mycoplasma gallisepticum in Guangdong Province, China

, , , , , ,  y   
28 nov 2024

Cite
Descargar portada

Fig. 1.

Isolation and identification of goose-origin Mycoplasma gallisepticum. A – thickened air-sac wall of an affected goose: wall with white viscous liquid; B – blood in statis in the lung tissue of an affected goose, and large amounts of yellow and white cheese-like material in the air sacs; C – colonies of clinical MG from goose isolates (100×); D – the PCR identification result of goose-origin MG. M – DL1000 Marker; 1 – MG-GD01/22; 2 – MG S6; 3 – Mycoplasma synoviae strain MS wvu1853; 4 – Control
Isolation and identification of goose-origin Mycoplasma gallisepticum. A – thickened air-sac wall of an affected goose: wall with white viscous liquid; B – blood in statis in the lung tissue of an affected goose, and large amounts of yellow and white cheese-like material in the air sacs; C – colonies of clinical MG from goose isolates (100×); D – the PCR identification result of goose-origin MG. M – DL1000 Marker; 1 – MG-GD01/22; 2 – MG S6; 3 – Mycoplasma synoviae strain MS wvu1853; 4 – Control

Fig. 2.

Changes caused by Mycoplasma gallisepticum in geese. A – clean nasal cavity; B – normal, thin and transparent air sacs in a control-group goose; C – yellow, viscous secretion in the nasal cavity of an infected-group goose; D – slightly thickened air sacs withs cloudy, light-yellow cheese-like exudation in an infected-group goose
Changes caused by Mycoplasma gallisepticum in geese. A – clean nasal cavity; B – normal, thin and transparent air sacs in a control-group goose; C – yellow, viscous secretion in the nasal cavity of an infected-group goose; D – slightly thickened air sacs withs cloudy, light-yellow cheese-like exudation in an infected-group goose

Fig. 3.

Basic information and bioinformatics prediction for Mycoplasma gallisepticum strain MG-GD01/22 isolated from inoculated Chinese geese. A – visualisation of the MG-GD01/22 genome; B – clustered, regularly interspaced short palindromic repeat fragment SeqLogo of MG-GD01/22. COG – clusters of orthologous groups; GC – guanine + cytosine; CDS – coding sequence; rRNA – ribosomal RNA; tRNA – transfer RNA
Basic information and bioinformatics prediction for Mycoplasma gallisepticum strain MG-GD01/22 isolated from inoculated Chinese geese. A – visualisation of the MG-GD01/22 genome; B – clustered, regularly interspaced short palindromic repeat fragment SeqLogo of MG-GD01/22. COG – clusters of orthologous groups; GC – guanine + cytosine; CDS – coding sequence; rRNA – ribosomal RNA; tRNA – transfer RNA

Fig. 4.

Functional analysis of the Mycoplasma gallisepticum strain MG-GD01/22 isolated from inoculated Chinese geese based on Cluster of Orthologous Groups (of proteins) (COG) database annotation results
Functional analysis of the Mycoplasma gallisepticum strain MG-GD01/22 isolated from inoculated Chinese geese based on Cluster of Orthologous Groups (of proteins) (COG) database annotation results

Fig. 5.

Functional analysis of the Mycoplasma gallisepticum strain MG-GD01 isolated from inoculated Chinese geese based on the Gene Ontology (GO) database annotation results
Functional analysis of the Mycoplasma gallisepticum strain MG-GD01 isolated from inoculated Chinese geese based on the Gene Ontology (GO) database annotation results

Fig. 6.

Functional analysis of the Mycoplasma gallisepticum strain MG-GD01 isolated from inoculated Chinese geese based on Kyoto Encyclopedia of Genes and Genomes (KEGG) database annotation results
Functional analysis of the Mycoplasma gallisepticum strain MG-GD01 isolated from inoculated Chinese geese based on Kyoto Encyclopedia of Genes and Genomes (KEGG) database annotation results

Fig. 7.

Nucleotide sequence homology analysis of the 16S ribosomal RNA of the Mycoplasma gallisepticum strain MG-GD01/22 isolated from inoculated Chinese geese
Nucleotide sequence homology analysis of the 16S ribosomal RNA of the Mycoplasma gallisepticum strain MG-GD01/22 isolated from inoculated Chinese geese

Fig. 8.

Phylogenetic tree of 16S ribosomal RNA of the Mycoplasma gallisepticum strain MG-GD01/22 (indicated by the red star) isolated from inoculated Chinese geese
Phylogenetic tree of 16S ribosomal RNA of the Mycoplasma gallisepticum strain MG-GD01/22 (indicated by the red star) isolated from inoculated Chinese geese

Fig. 9.

Phylogenetic tree of mgc2 of MG-GD01/22 (indicated by the red star) isolated from inoculated Chinese geese
Phylogenetic tree of mgc2 of MG-GD01/22 (indicated by the red star) isolated from inoculated Chinese geese

Fig. 10.

Collinearity analysis of the genomes of the Mycoplasma gallisepticum strain MG-GD01/22 (x-axis) isolated from inoculated Chinese geese and the MG S6 strain (y-axis). Forward maximal unique matches (MUMs) are plotted as red lines/dots while reverse MUMs are plotted as blue lines/dots. A line of dots with slope = 1 represents an undisturbed segment of conservation between the two sequences, while a line of slope = −1 represents an inverted segment of conservation between the two sequences
Collinearity analysis of the genomes of the Mycoplasma gallisepticum strain MG-GD01/22 (x-axis) isolated from inoculated Chinese geese and the MG S6 strain (y-axis). Forward maximal unique matches (MUMs) are plotted as red lines/dots while reverse MUMs are plotted as blue lines/dots. A line of dots with slope = 1 represents an undisturbed segment of conservation between the two sequences, while a line of slope = −1 represents an inverted segment of conservation between the two sequences

The bioinformatics software used for the prediction and annotation of Mycoplasma gallisepticum strain MG-GD01/22 isolated from inoculated Chinese geese

Database Website
NR HYPERLINK https://www.ncbi.nlm.nih.gov/refseq/about/nonredundantproteins/
SwissProt HYPERLINK http://www.ebi.ac.uk/swissprot/
COG HYPERLINK https://www.ncbi.nlm.nih.gov/research/cog-project/
GO HYPERLINK http://www.geneontology.org
KEGG HYPERLINK http://www.kegg.jp/orhttp://www.genome.jp/kegg/
VFDB HYPERLINK http://www.mgc.ac.cn/VFs/
CARD HYPERLINK http://arpcard.mcmaster.ca
PHI-base HYPERLINK http://www.phi-base.org/index.jsp
CAZy HYPERLINK http://www.cazy.org/

PCR reaction system for amplification of Mycoplasma isolates from air-sac tissue of Chinese geese inoculated with Mycoplasma gallisepticum

Component Volume (μL)
TaKaRa Taq Version 2.0 plus dye 5
Forward primer (10μM) 0.3
Reverse primer (10μM) 0.3
ddH2O 3.4
Bacteria solution 1

Primers used for PCR analysis of amplicons of Mycoplasma from air-sac tissue of Chinese geese inoculated with Mycoplasma gallisepticum

Species Primer sequences 5’→3’ Fragment length (bp) Annealing temperature (°C)
IGSR-F:GTAGGGCCGGTGATTGGAGTTA
Mycoplasma gallisepticum IGSR-R:CCCGTAGCATTTCGCAGGTTTG 792 57

Pathogen Host Interactions database analysis of the Mycoplasma gallisepticum strain MG-GD01 isolated from inoculated Chinese geese

Taxon Gene name Gene number
Loss of pathogenicity pmc1, cls 10
Increased virulence algT, gyrA, glyA 7
Effector pstB, groEL 7
Unaffected pathogenicity FTT0673p/prsAp, secA2 3
Reduced virulence secA, Calcium-transporting 2

Minimum inhibitory concentrations (MICs) of antimicrobials against a Mycoplasma gallisepticum reference strain (MG S6) and the isolate obtained in the experiment (MG-GD01)

Drug name MG S6 MIC MG-GD01 MIC
Danofloxacin 0.8 3.2
Enrofloxacin 0.4 3.2
Tilmicosin 0.2 0.4
Tylosin 0.2 0.4
Acetylisovalery ltylosin tartrate 0.1 0.3
Tiamulin 0.00625 0.0125
Valnemulin 0.00625 0.0125
Spectinomycin 0.4 3.2

The Comprehensive Antibiotic Resistance Database analysis of the Mycoplasma gallisepticum strain MG-GD01 isolated from inoculated Chinese geese

Antibiotic type Gene name Gene number
Fluoroquinolone parC, gyrB, parE, gyrA 10
Streptomycin rpsL 1
Aminocoumarin alaS, gyrB, parE, parY 7
Daptomycin rpoB, rpoC 3
Rifamycin rpoB 2
Other antibiotics macB, dfrE 2