Whole genome sequencing and analysis of a goose-derived Mycoplasma gallisepticum in Guangdong Province, China

Fig. 1.

Fig. 2.

Fig. 3.

Fig. 4.

Fig. 5.

Fig. 6.

Fig. 7.

Fig. 8.

Fig. 9.

Fig. 10.

The bioinformatics software used for the prediction and annotation of Mycoplasma gallisepticum strain MG-GD01/22 isolated from inoculated Chinese geese

Database	Website
NR	HYPERLINK https://www.ncbi.nlm.nih.gov/refseq/about/nonredundantproteins/
SwissProt	HYPERLINK http://www.ebi.ac.uk/swissprot/
COG	HYPERLINK https://www.ncbi.nlm.nih.gov/research/cog-project/
GO	HYPERLINK http://www.geneontology.org
KEGG	HYPERLINK http://www.kegg.jp/orhttp://www.genome.jp/kegg/
VFDB	HYPERLINK http://www.mgc.ac.cn/VFs/
CARD	HYPERLINK http://arpcard.mcmaster.ca
PHI-base	HYPERLINK http://www.phi-base.org/index.jsp
CAZy	HYPERLINK http://www.cazy.org/

PCR reaction system for amplification of Mycoplasma isolates from air-sac tissue of Chinese geese inoculated with Mycoplasma gallisepticum

Component	Volume (μL)
TaKaRa Taq Version 2.0 plus dye	5
Forward primer (10μM)	0.3
Reverse primer (10μM)	0.3
ddH2O	3.4
Bacteria solution	1

Primers used for PCR analysis of amplicons of Mycoplasma from air-sac tissue of Chinese geese inoculated with Mycoplasma gallisepticum

Species	Primer sequences 5’→3’	Fragment length (bp)	Annealing temperature (°C)
	IGSR-F:GTAGGGCCGGTGATTGGAGTTA
Mycoplasma gallisepticum	IGSR-R:CCCGTAGCATTTCGCAGGTTTG	792	57

Pathogen Host Interactions database analysis of the Mycoplasma gallisepticum strain MG-GD01 isolated from inoculated Chinese geese

Taxon	Gene name	Gene number
Loss of pathogenicity	pmc1, cls	10
Increased virulence	algT, gyrA, glyA	7
Effector	pstB, groEL	7
Unaffected pathogenicity	FTT0673p/prsAp, secA2	3
Reduced virulence	secA, Calcium-transporting	2

Minimum inhibitory concentrations (MICs) of antimicrobials against a Mycoplasma gallisepticum reference strain (MG S6) and the isolate obtained in the experiment (MG-GD01)

Drug name	MG S6 MIC	MG-GD01 MIC
Danofloxacin	0.8	3.2
Enrofloxacin	0.4	3.2
Tilmicosin	0.2	0.4
Tylosin	0.2	0.4
Acetylisovalery ltylosin tartrate	0.1	0.3
Tiamulin	0.00625	0.0125
Valnemulin	0.00625	0.0125
Spectinomycin	0.4	3.2

The Comprehensive Antibiotic Resistance Database analysis of the Mycoplasma gallisepticum strain MG-GD01 isolated from inoculated Chinese geese

Antibiotic type	Gene name	Gene number
Fluoroquinolone	parC, gyrB, parE, gyrA	10
Streptomycin	rpsL	1
Aminocoumarin	alaS, gyrB, parE, parY	7
Daptomycin	rpoB, rpoC	3
Rifamycin	rpoB	2
Other antibiotics	macB, dfrE	2