Protective effects of Bacillus subtilis fermentation extract against ochratoxin A-induced nephrotoxicity and immunotoxicity in broiler chickens
, , , , y
05 jul 2022
Acerca de este artículo
Publicado en línea: 05 jul 2022
Páginas: 167 - 177
Recibido: 27 ene 2022
Aceptado: 31 may 2022
DOI: https://doi.org/10.2478/jvetres-2022-0030
Palabras clave
© 2022 M.A. Elhady et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.
Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

Fig. 6

Fig. 7

Fig. 8

Microscopic lesion scoring of the examined organs in different groups
Lesion | Control | OTA | BSFE | OTA + BSFE |
---|---|---|---|---|
Microscopic renal lesion scoring | ||||
RTD | 0 a | 5 b | 0 a | 3 c |
RTN | 0 a | 5 b | 0 a | 3 c |
RTP | 0 a | 3 b | 0 a | 2 c |
Inflammation | 0 a | 5 b | 0 a | 1 c |
Haemorrhaging | 0 a | 2 b | 0 a | 1 c |
Congestion | 0 a | 3 c | 1 b | 1 b |
Glomerular hypercellularity | 0 a | 3 b | 0 a | 0 a |
Glomerular degeneration | 0 a | 4 b | 0 a | 2 c |
Microscopic splenic lesion scoring | ||||
Lymphocytolysis | 0 a | 3 b | 0 a | 0 a |
Congestion | 0 a | 3 b | 0 a | 1 c |
Microscopic thymic lesion scoring | ||||
Lymphocytolysis | 0 a | 4 b | 0 a | 0 a |
Congestion | 0 a | 2 b | 0 a | 0 a |
Microscopic bursal lesion scoring | ||||
Lymphocytolysis | 0 a | 5 b | 0 a | 1 c |
Congestion | 0 a | 2 b | 0 a | 0 a |
0 a | 4 b | 0 a | 0 a |
Ochratoxin A levels in serum and tissues
Sample | Control | OTA | BSFE | OTA + BSFE |
---|---|---|---|---|
Serum (μg/L) | < LOD1 | 11.3 ± 1.7 | < LOD | 6.6 ± 1.37 ^ |
Kidney (μg/Kg) | < LOD | 26.67 ± 6.03 | < LOD | 12.3 ± 4.36 ^ |
Liver (μg/Kg) | < LOD | 14.83 ± 2.84 | < LOD | 5.25 ± 1.52 ^ |
Muscle (μg/Kg) | < LOD | 8.77 ± 1.97 | < LOD | 2.9 ± 0.85 ^ |
The primer sequences used in gene expression analysis
Primer | Sequence | Accession number | Amplicon size (bp) |
---|---|---|---|
F: TTCAAGCGAAAACAGGGTGG |
NM_205339.2 | 167 | |
F: CACCTTTGTCTCACCTGTGC |
XM_015290060.2 | 241 | |
F: TTGAAGCAGACAGTGGACCA |
NM_204725.1 | 177 | |
F: CCCACACCCCTGTGATGAAAR: |
NM_205518.1 | 177 |