Accesso libero

Protective effects of Bacillus subtilis fermentation extract against ochratoxin A-induced nephrotoxicity and immunotoxicity in broiler chickens

INFORMAZIONI SU QUESTO ARTICOLO

Cita

Fig. 1

Impacts of ochratoxin A (OTA) and/or Bacillus subtilis fermentation extract (BSFE) on the specific antibody titres 21 days after vaccination (n = 5 birds/group)* – P < 0.05 versus control group; ^ – P < 0.05 versus OTA group
Impacts of ochratoxin A (OTA) and/or Bacillus subtilis fermentation extract (BSFE) on the specific antibody titres 21 days after vaccination (n = 5 birds/group)* – P < 0.05 versus control group; ^ – P < 0.05 versus OTA group

Fig. 2

Impacts of ochratoxin A (OTA) and/or Bacillus subtilis fermentation extract (BSFE) on swelling of the toe web skin 21 days after phytohaemagglutinin-P injection (n = 5 birds/group)* – P < 0.05 versus control group; ^ – P < 0.05 versus OTA group
Impacts of ochratoxin A (OTA) and/or Bacillus subtilis fermentation extract (BSFE) on swelling of the toe web skin 21 days after phytohaemagglutinin-P injection (n = 5 birds/group)* – P < 0.05 versus control group; ^ – P < 0.05 versus OTA group

Fig. 3

Analysis of serum metabolic wastes in chickens after exposure to ochratoxin A (OTA) and/or Bacillus subtilis fermentation extract (BSFE) (n = 5 birds/group)CRE – creatinine; UA – uric acid; BUN – blood urea nitrogen; * – P < 0.05 versus control group; ^ – P <0.05 versus OTA group
Analysis of serum metabolic wastes in chickens after exposure to ochratoxin A (OTA) and/or Bacillus subtilis fermentation extract (BSFE) (n = 5 birds/group)CRE – creatinine; UA – uric acid; BUN – blood urea nitrogen; * – P < 0.05 versus control group; ^ – P <0.05 versus OTA group

Fig. 4

Impacts of ochratoxin A (OTA) and/or Bacillus subtilis fermentation extract (BSFE) on the levels of oxidative and antioxidative parameters in the kidney and immune tissues (n = 5 birds/group)MDA – malondialdehyde; CAT – catalase; GSH – glutathione; * – P < 0.05 versus control group; ^ – P < 0.05 versus OTA group
Impacts of ochratoxin A (OTA) and/or Bacillus subtilis fermentation extract (BSFE) on the levels of oxidative and antioxidative parameters in the kidney and immune tissues (n = 5 birds/group)MDA – malondialdehyde; CAT – catalase; GSH – glutathione; * – P < 0.05 versus control group; ^ – P < 0.05 versus OTA group

Fig. 5

Photomicrograph of kidney tissue sections stained by haematoxylin and eosin. a – control group with normal histological structure; b–d – ochratoxin A (OTA) group showing vacuolar degeneration (black arrows), necrosis (blue arrow) and desquamation (red arrows) of tubular epithelium, tubular and interstitial inflammatory cell infiltration (black triangles) and interstitial haemorrhage (black stars); e–f – Bacillus subtilis fermentation extract + OTA group showing moderate vacuolar degeneration (black arrows) in some tubular epithelial cells and mild interstitial inflammatory cell infiltration (black triangles)
Photomicrograph of kidney tissue sections stained by haematoxylin and eosin. a – control group with normal histological structure; b–d – ochratoxin A (OTA) group showing vacuolar degeneration (black arrows), necrosis (blue arrow) and desquamation (red arrows) of tubular epithelium, tubular and interstitial inflammatory cell infiltration (black triangles) and interstitial haemorrhage (black stars); e–f – Bacillus subtilis fermentation extract + OTA group showing moderate vacuolar degeneration (black arrows) in some tubular epithelial cells and mild interstitial inflammatory cell infiltration (black triangles)

Fig. 6

Photomicrograph of spleen (a–d) and thymus (e–h) tissue sections stained by haematoxylin and eosin. a and e – control group with normal histological structure; b and f, c and g – ochratoxin A (OTA) group showing lymphocytic cell depletion and lymphocytolysis (black triangles), multifocal areas of necrosis (circles), thinning in the cortical layer (black arrow) and expansion with extensive necrosis of medulla (black star); d and h – Bacillus subtilis fermentation extract + OTA group showing normal histological structure
Photomicrograph of spleen (a–d) and thymus (e–h) tissue sections stained by haematoxylin and eosin. a and e – control group with normal histological structure; b and f, c and g – ochratoxin A (OTA) group showing lymphocytic cell depletion and lymphocytolysis (black triangles), multifocal areas of necrosis (circles), thinning in the cortical layer (black arrow) and expansion with extensive necrosis of medulla (black star); d and h – Bacillus subtilis fermentation extract + OTA group showing normal histological structure

Fig. 7

Photomicrograph of bursal tissue sections stained by haematoxylin and eosin. a – control group with normal histological architecture; b–d – ochratoxin A (OTA) group showing lymphocytic cell necrosis with large number of phagocytic cells (black triangles), interstitial widening by fibrinous exudate and inflammatory cell infiltration (black stars) and atrophy of the lobules with extensive corrugation of the basement membrane (black arrows); e and f – Bacillus subtilis fermentation extract + OTA group showing mild medullary lymphocytolysis (black triangles) and widening of the interfollicular septa by oedema and infiltration by a few inflammatory cells (black star)
Photomicrograph of bursal tissue sections stained by haematoxylin and eosin. a – control group with normal histological architecture; b–d – ochratoxin A (OTA) group showing lymphocytic cell necrosis with large number of phagocytic cells (black triangles), interstitial widening by fibrinous exudate and inflammatory cell infiltration (black stars) and atrophy of the lobules with extensive corrugation of the basement membrane (black arrows); e and f – Bacillus subtilis fermentation extract + OTA group showing mild medullary lymphocytolysis (black triangles) and widening of the interfollicular septa by oedema and infiltration by a few inflammatory cells (black star)

Fig. 8

Impacts of ochratoxin A (OTA) and/ or Bacillus subtilis fermentation extract (BSFE) on gene expression levels of apoptosis-related genes in different tissues of broiler chickens (n = 3 birds/ group)BCL-2 – B-cell lymphoma 2 protein; BAX – BCL-2-associated X protein; CASP-3 – caspase 3; * – P < 0.05 versus control group; ^ – P < 0.05 versus OTA group
Impacts of ochratoxin A (OTA) and/ or Bacillus subtilis fermentation extract (BSFE) on gene expression levels of apoptosis-related genes in different tissues of broiler chickens (n = 3 birds/ group)BCL-2 – B-cell lymphoma 2 protein; BAX – BCL-2-associated X protein; CASP-3 – caspase 3; * – P < 0.05 versus control group; ^ – P < 0.05 versus OTA group

Microscopic lesion scoring of the examined organs in different groups

Lesion Control OTA BSFE OTA + BSFE
Microscopic renal lesion scoring
RTD 0 a 5 b 0 a 3 c
RTN 0 a 5 b 0 a 3 c
RTP 0 a 3 b 0 a 2 c
Inflammation 0 a 5 b 0 a 1 c
Haemorrhaging 0 a 2 b 0 a 1 c
Congestion 0 a 3 c 1 b 1 b
Glomerular hypercellularity 0 a 3 b 0 a 0 a
Glomerular degeneration 0 a 4 b 0 a 2 c
Microscopic splenic lesion scoring
Lymphocytolysis 0 a 3 b 0 a 0 a
Congestion 0 a 3 b 0 a 1 c
Microscopic thymic lesion scoring
Lymphocytolysis 0 a 4 b 0 a 0 a
Congestion 0 a 2 b 0 a 0 a
Microscopic bursal lesion scoring
Lymphocytolysis 0 a 5 b 0 a 1 c
Congestion 0 a 2 b 0 a 0 a
0 a 4 b 0 a 0 a

Ochratoxin A levels in serum and tissues

Sample Control OTA BSFE OTA + BSFE
Serum (μg/L) < LOD1 11.3 ± 1.7 < LOD 6.6 ± 1.37 ^
Kidney (μg/Kg) < LOD 26.67 ± 6.03 < LOD 12.3 ± 4.36 ^
Liver (μg/Kg) < LOD 14.83 ± 2.84 < LOD 5.25 ± 1.52 ^
Muscle (μg/Kg) < LOD 8.77 ± 1.97 < LOD 2.9 ± 0.85 ^

The primer sequences used in gene expression analysis

Primer Sequence Accession number Amplicon size (bp)
Bcl-2 F: TTCAAGCGAAAACAGGGTGGR: CTCTGAGCACATGGAAAGCC NM_205339.2 167
Bax F: CACCTTTGTCTCACCTGTGCR: GATGGCAGTGATGAGCATGG XM_015290060.2 241
CASP-3 F: TTGAAGCAGACAGTGGACCAR: GTTCAAGTTTCCTGGCGTGT NM_204725.1 177
β-actin F: CCCACACCCCTGTGATGAAAR:TAGAACTTTGGGGGCGTTCG NM_205518.1 177
eISSN:
2450-8608
Lingua:
Inglese
Frequenza di pubblicazione:
4 volte all'anno
Argomenti della rivista:
Life Sciences, Molecular Biology, Microbiology and Virology, other, Medicine, Veterinary Medicine