Acceso abierto

Room-temperature stable loop-mediated isothermal amplification (LAMP) reagents to detect leptospiral DNA

, ,  y   
20 ago 2021

Cite
Descargar portada

Figure 1

LAMP endpoint product on day 1 with the premixed LAMP reagents stored at room temperature. (A) Without sugar. (B) With 4% (w/v) sucrose (final concentration, storage at 8%). The following apply to (A) and (B). 1–6: Rat kidney samples confirmed for negative leptospiral DNA. 7–12: Rat kidney samples confirmed positive for leptospiral DNA. (i) Colorimetric observation based on the change in the color of calcein dye. (ii) Fluorescence emission under UV light. (iii) Electrophoresis of LAMP products in 1.5% agarose gel at 90 V for 45 min with ethidium bromide staining. Yellow boxes indicate positive LAMP amplification where calcein dye changes from orange to green, emission of fluorescence, and ladder-like bands. Products in the gel are visualized at 254 nm using a UV Transilluminator 2000 (Bio-Rad). A positive amplification in LAMP is indicated by the formation of ladder-like bands, due to the working principle of LAMP. No size marker was used on the gel as identification of a single discrete band is not possible with LAMP. All images are representative of at least 3 replicate experiments. LAMP, loop-mediated isothermal amplification; NC, nontemplate control; TC, template control; UV, ultraviolet.
LAMP endpoint product on day 1 with the premixed LAMP reagents stored at room temperature. (A) Without sugar. (B) With 4% (w/v) sucrose (final concentration, storage at 8%). The following apply to (A) and (B). 1–6: Rat kidney samples confirmed for negative leptospiral DNA. 7–12: Rat kidney samples confirmed positive for leptospiral DNA. (i) Colorimetric observation based on the change in the color of calcein dye. (ii) Fluorescence emission under UV light. (iii) Electrophoresis of LAMP products in 1.5% agarose gel at 90 V for 45 min with ethidium bromide staining. Yellow boxes indicate positive LAMP amplification where calcein dye changes from orange to green, emission of fluorescence, and ladder-like bands. Products in the gel are visualized at 254 nm using a UV Transilluminator 2000 (Bio-Rad). A positive amplification in LAMP is indicated by the formation of ladder-like bands, due to the working principle of LAMP. No size marker was used on the gel as identification of a single discrete band is not possible with LAMP. All images are representative of at least 3 replicate experiments. LAMP, loop-mediated isothermal amplification; NC, nontemplate control; TC, template control; UV, ultraviolet.

Figure 2

LAMP products on day 45 with the premixed LAMP reagent supplemented with sucrose and stored at room temperature. The following apply to all panels; 1–6: Rat kidney samples confirmed for negative leptospiral DNA. 7–12: Rat kidney samples confirmed positive for leptospiral DNA. (i) Colorimetric observation based on the change in the color of calcein dye. (ii) Fluorescence emission under UV light. (iii) Electrophoresis of LAMP products in 1.5% agarose gel at 90 V for 45 min with ethidium bromide staining. Yellow boxes indicate positive LAMP amplification where calcein dye changes from orange to yellow–green, emission of fluorescence, and ladder-like bands. Products in the gel are visualized at 254 nm using a UV Transilluminator 2000 (Bio-Rad). A positive amplification in LAMP is indicated by the formation of ladder-like bands. No size marker was used on the gel as identification of a single discrete band is not possible with LAMP. All images are representative of at least 3 replicate experiments. LAMP, loop-mediated isothermal amplification; NC, nontemplate control; TC, Template control; UV, ultraviolet.
LAMP products on day 45 with the premixed LAMP reagent supplemented with sucrose and stored at room temperature. The following apply to all panels; 1–6: Rat kidney samples confirmed for negative leptospiral DNA. 7–12: Rat kidney samples confirmed positive for leptospiral DNA. (i) Colorimetric observation based on the change in the color of calcein dye. (ii) Fluorescence emission under UV light. (iii) Electrophoresis of LAMP products in 1.5% agarose gel at 90 V for 45 min with ethidium bromide staining. Yellow boxes indicate positive LAMP amplification where calcein dye changes from orange to yellow–green, emission of fluorescence, and ladder-like bands. Products in the gel are visualized at 254 nm using a UV Transilluminator 2000 (Bio-Rad). A positive amplification in LAMP is indicated by the formation of ladder-like bands. No size marker was used on the gel as identification of a single discrete band is not possible with LAMP. All images are representative of at least 3 replicate experiments. LAMP, loop-mediated isothermal amplification; NC, nontemplate control; TC, Template control; UV, ultraviolet.

LAMP primer sequences for secY of Leptospira

Primer Sequence (5′ – 3′)
F3 CTTGTTCCTGCCCTTCAAA
B3 TTCGGTGATCTGTTCTCCT
FIP TTCCGTGCCGGTAGACCA-GAACCGTAATTCTTTGTGCG
BIP CTTGAGCCTGCGCGTTAC-AATGAGAAGAACGGTTCCG
LF GCGAGTTGGATCACTGCTA
LB CCGGGCTTAATCAATTCTTCTG