Nucleic acid amplification is regarded as one of the most valued methods for assay requirements ranging from biotechnology to diagnosis of infectious diseases [1]. For decades, nucleic acid amplification has played a substantial role in addressing the challenges of disease diagnosis. Leptospirosis is a zoonotic disease in which rats are regarded as the major reservoir of leptospirosis infection because they usually remain as permanent bacterial carriers [2]. In Malaysia, leptospirosis outbreaks are often reported following heavy rainfall in affected areas. The rainfall tends to wash out rat holes, introducing leptospiral bacteria to water bodies and the soil surface, resulting in contamination of water and soil, which serve as a transmission route to humans. Despite substantial efforts to control and prevent disease outbreaks, leptospirosis infections continue to cause deaths and high morbidity among human populations [3].
Disease surveillance of leptospirosis through early detection of leptospire in rats in disease hot-spots is crucial to minimize the risk of human infection and to prevent disease outbreaks. Khairani-Bejo et al. reported the presence of leptospiral bacteria in rats captured in a residential area of Serdang, Selangor, Malaysia, and their study demonstrated that polymerase chain reaction (PCR) has better sensitivity to detect leptospiral bacteria in rats than the usual methods of culture and microscopic agglutination (MAT), which are more time-consuming and laborious [4]. Benacer et al. trapped 300 urban rats at 3 sites in Kuala Lumpur found that 20, mostly from the Chow Kit Market in Kuala Lumpur, Malaysia were positive for
In 2000, a novel nucleic acid assay method named LAMP was first described to amplify millions of copies of bacterial DNA in a single tube in less than an hour with high specificity and sensitivity [8]. LAMP is based on an autocycling strand-displacement reaction by using a set of 4–6 oligonucleotides that recognize 6–8 DNA sequences within their target genomic region and form a loop-structured amplicon. Loop primers may also be used to improve amplification. Crucially, LAMP is amplified at a constant temperature within the range of 60–65 °C [1]. Thereby, LAMP overcomes the limitation of PCR of the need for specialized equipment [8, 9]. LAMP has the potential to detect nucleic acid of
Several advances toward the application of LAMP as a point-of-care detection method have been reported including electric LAMP, lyophilized LAMP, lateral flow assay LAMP, micro-LAMP, and multiplex LAMP. Lyophilized LAMP is used to describe the form of LAMP reagents processed by freeze-drying the reagents to allow their storage at room temperature [1]. Foo et al. reported development of a thermo-stabilized triplex LAMP assay with addition of raffinose as stabilizer before freeze-drying the reagents, thus eliminating the need for cold storage [11]. However, this method is not a good alternative because it is tedious and requires certain expertise of handling the operation of the freeze-dryer.
The nonreducing disaccharide sucrose provides thermal protection to
A set of 6 primers designed in a previous study [10] was utilized to perform the LAMP assay by targeting a 276 bp DNA fragment spanning the
LAMP primer sequences for
F3 | CTTGTTCCTGCCCTTCAAA |
B3 | TTCGGTGATCTGTTCTCCT |
FIP | TTCCGTGCCGGTAGACCA-GAACCGTAATTCTTTGTGCG |
BIP | CTTGAGCCTGCGCGTTAC-AATGAGAAGAACGGTTCCG |
LF | GCGAGTTGGATCACTGCTA |
LB | CCGGGCTTAATCAATTCTTCTG |
The genomic sequence of
LAMP, loop-mediated isothermal amplification.
The utilization of rat kidney samples in this study was approved by the animal ethics committee of Universiti Kebangsaan Malaysia (UKMAEC) with the reference number FST/2016/AR-CAT2 and complied with national and international guidelines for the use of animals in research including the U.S. Animal Welfare Act (Public Law 89–554, 1966) including any amendments passed to 2008 as described in the USDA Blue Book (2020) including field research as described in the OLAW Institutional Animal Care and Use Committee Guidebook (2nd edition 2002), did not endanger any small or declining animal populations, and was compliant with the Convention on Biological Diversity and IUCN policy statement. Reporting follows ARRIVE 2.0 guidelines for animal research [14]. Rats (
The preparation of premixed LAMP reagents was adapted from Foo et al., with modifications to avoid the use of a freeze-drying process and changes to the type of sugar used [11]. The selection of sucrose to test for its applicability in LAMP was adapted from Chen et al. [9]. Thus, 20 g of sucrose (CAS 57-50-1, molecular biology grade, catalog No. S0389, Sigma-Aldrich) was weighed and mixed with 100 mL of nuclease-free water to make 20% (w/v) sucrose.
The 2× premixed LAMP reagents were comprised of 2× ThermoPol buffer (New England Biolabs), 12 mM of MgSO4 (New England Biolabs), 2.8 mM dNTPs (First Base Laboratories, Malaysia), 0.8 M betaine (Sigma-Aldrich), 8% (w/v) sucrose, 8 units of
Briefly, 25 μL of the LAMP reaction mixture contained 12.5 μL of 2× premixed LAMP reagents, 1 μL of calcein dye (Nacalai Tesque, Japan, CAS1461-15-0, product No. 06713-61; 1.25 mM calcein dye and 12.5 mM MnCl2), 5 pmol each of F3 and B3 primers, 40 pmol each of FIP and BIP primers, 20 pmol each of the LF and LB primers, various volumes of the samples (300 ng of DNA), and nuclease-free water. A positive control template containing
LAMP represents an attractive approach for rapid and deployable pathogen detection. Since its development by Notomi et al. [8], LAMP has been widely used as a molecular detection tool. One of the most outstanding advantages of LAMP is its speed. For instance, LAMP results can be obtained within 30 min, whereas PCR, which is one of the most widely used molecular detection tools, would require at least 90 min to obtain a result. However, the most critical advantage of LAMP is its simplicity whereby LAMP runs under isothermal conditions, and the method requires only a water bath or heating block [1].
To date, the usage of LAMP has been widely reported and most studies have highlighted its advantage of being rapid, while capable of detecting pathogens with high sensitivity and specificity [7, 8]. Due to its advantages, LAMP is particularly useful in epidemics as a rapid diagnostic tool to play a vital role in outbreak management. For example, during the current coronavirus disease 2019 (COVID-19) pandemic, LAMP has been deployed as molecular tool to detect and contain the spread of COVID-19 [16]. Similarly, LAMP may be used as a method to detect and control the spread of leptospirosis. Unfortunately, the requirement of cold storage of LAMP reagents limits the application of the method, especially in resource-limited settings where cold storage facilities are limited [7].
Alternatively, researchers have opted for lyophilized LAMP to eliminate the use of cold storage. Engku Nur Syafiraha et al. indicated that lyophilization of LAMP reagents with addition of sugar in LAMP enabled the reagent to maintain functionality and stability at room temperature [7]. However, a drawback of lyophilization lies in the requirement for sophisticated equipment such as a rotary or manifold freeze-dryer. The use of a freeze-dryer may alter material structure, which could affect the sensitivity and specificity of the test. Moreover, freeze-dryers are expensive and not readily available in many laboratories or in resource-limited settings [13].
Othman et al. developed and optimized a LAMP protocol using clinical and animal samples targeting the same
The LAMP reaction using the sucrose-free premixed reagents stored at room temperature showed no amplification in all rat kidney samples on day 1 (
LAMP endpoint product on day 1 with the premixed LAMP reagents stored at room temperature.
LAMP products on day 45 with the premixed LAMP reagent supplemented with sucrose and stored at room temperature. The following apply to all panels; 1–6: Rat kidney samples confirmed for negative leptospiral DNA. 7–12: Rat kidney samples confirmed positive for leptospiral DNA.
To date, studies on the use of sugar in LAMP reagents remain limited. Most of the studies reported have used treha-lose as stabilizer for the LAMP reagents because trehalose has been reported to provide a good stability for proteins in room temperature storage [7, 9]. However, others indicated that sucrose tends to provide better stability to maintain the enzymatic activity than trehalose [17]. Foo et al. adapted the preparation of premixed LAMP reagents with minor modifications of the use of a freeze-drying process and the type of sugar [11]. Meanwhile, the selection of sucrose was inspired by the study by Chen et al. to test for its applicability in the LAMP method [9]. Sucrose has been used widely to preserve enzymatic activity because it provides good stabilizing effects and the recovery of glucose-6-phosphate dehydrogenase activity in its presence is 94%–98% [18]. Sucrose can tolerate various temperature conditions and resist dehydration, while allowing reagents to be stored at room temperature [19]. Louwrier and Valk described that sucrose can maintain the enzymatic activity of
Although the exact mechanism of thermal protection by sucrose remains unclear, it is presumed that the possible mechanism of sugar in preserving the protein is due to a “glassy dynamics” hypothesis in which the “sugar forms a rigid, inert matrix in which the protein is molecularly dispersed, and the limited mobility in the glassy matrix dampens the protein mobility necessary for movement along the degradation pathway” [17]. As a result, degradation of protein is reduced by its kinetic control. In the present study, we found that sucrose maintained the enzymatic activity of the
Detection of leptospiral DNA in rat kidney samples using the room-temperature stable premixed LAMP reagents suggests that the method may also be applied to detect leptospiral DNA in clinical samples. The modification introduced in the present study would enhance the original LAMP method [10] attributes of ease-of-operation, minimal training requirements, and cost-effectiveness, thereby enhancing its potential as a point-of-care-testing method. The elimination of cold storage and machine dependence would allow the modified LAMP to be used on site to detect
There are some limitations to the present study. Various concentrations of sucrose were not tested. Thus, we are uncertain whether another concentration would provide better stability of LAMP reagents. The present study only tested sucrose. Further studies that test other concentrations of sucrose and types of sugar to optimize conditions to preserve activity of
This improved method addresses the limitations of cold storage requirements for LAMP reagents. The premixed LAMP reagents with sucrose as stabilizer could maintain the