Uneingeschränkter Zugang

Room-temperature stable loop-mediated isothermal amplification (LAMP) reagents to detect leptospiral DNA

Pui-Yuei Lee

Pui-Yuei Lee

Department of Medical Microbiology and Parasitology, Faculty of Medicine and Health Sciences, Universiti Putra MalaysiaSerdang, Malaysia
Orcid-Profil
Suche nach diesem Autor auf
Sciendo|Google Scholar
Lee, Pui-Yuei
, 
Yien-Ping Wong

Yien-Ping Wong

Department of Medical Microbiology and Parasitology, Faculty of Medicine and Health Sciences, Universiti Putra MalaysiaSerdang, Malaysia
Orcid-Profil
Suche nach diesem Autor auf
Sciendo|Google Scholar
Wong, Yien-Ping
, 
Shuhaidah Othman

Shuhaidah Othman

Department of Medical Microbiology and Parasitology, Faculty of Medicine and Health Sciences, Universiti Putra MalaysiaSerdang, Malaysia
Orcid-Profil
Suche nach diesem Autor auf
Sciendo|Google Scholar
Othman, Shuhaidah
 und 
Hui-Yee Chee

Hui-Yee Chee

Department of Medical Microbiology and Parasitology, Faculty of Medicine and Health Sciences, Universiti Putra MalaysiaSerdang, Malaysia
Orcid-Profil
Suche nach diesem Autor auf
Sciendo|Google Scholar
Chee, Hui-Yee
  
20. Aug. 2021
Room-temperature stable loop-mediated isothermal amplification (LAMP) reagents to detect leptospiral DNA's Cover Image
Über diesen Artikel
Vorheriger Artikel
Nächster Artikel
Zitieren
COVER HERUNTERLADEN
Artikel-Kategorie: Technical report
Online veröffentlicht: 20. Aug. 2021
Seitenbereich: 183 - 189
DOI: https://doi.org/10.2478/abm-2021-0023
Schlüsselwörter
© 2021 Pui-Yuei Lee et al., published by Sciendo
This work is licensed under the Creative Commons Attribution 4.0 International License.

Figure 1

LAMP endpoint product on day 1 with the premixed LAMP reagents stored at room temperature. (A) Without sugar. (B) With 4% (w/v) sucrose (final concentration, storage at 8%). The following apply to (A) and (B). 1–6: Rat kidney samples confirmed for negative leptospiral DNA. 7–12: Rat kidney samples confirmed positive for leptospiral DNA. (i) Colorimetric observation based on the change in the color of calcein dye. (ii) Fluorescence emission under UV light. (iii) Electrophoresis of LAMP products in 1.5% agarose gel at 90 V for 45 min with ethidium bromide staining. Yellow boxes indicate positive LAMP amplification where calcein dye changes from orange to green, emission of fluorescence, and ladder-like bands. Products in the gel are visualized at 254 nm using a UV Transilluminator 2000 (Bio-Rad). A positive amplification in LAMP is indicated by the formation of ladder-like bands, due to the working principle of LAMP. No size marker was used on the gel as identification of a single discrete band is not possible with LAMP. All images are representative of at least 3 replicate experiments. LAMP, loop-mediated isothermal amplification; NC, nontemplate control; TC, template control; UV, ultraviolet.
LAMP endpoint product on day 1 with the premixed LAMP reagents stored at room temperature. (A) Without sugar. (B) With 4% (w/v) sucrose (final concentration, storage at 8%). The following apply to (A) and (B). 1–6: Rat kidney samples confirmed for negative leptospiral DNA. 7–12: Rat kidney samples confirmed positive for leptospiral DNA. (i) Colorimetric observation based on the change in the color of calcein dye. (ii) Fluorescence emission under UV light. (iii) Electrophoresis of LAMP products in 1.5% agarose gel at 90 V for 45 min with ethidium bromide staining. Yellow boxes indicate positive LAMP amplification where calcein dye changes from orange to green, emission of fluorescence, and ladder-like bands. Products in the gel are visualized at 254 nm using a UV Transilluminator 2000 (Bio-Rad). A positive amplification in LAMP is indicated by the formation of ladder-like bands, due to the working principle of LAMP. No size marker was used on the gel as identification of a single discrete band is not possible with LAMP. All images are representative of at least 3 replicate experiments. LAMP, loop-mediated isothermal amplification; NC, nontemplate control; TC, template control; UV, ultraviolet.

Figure 2

LAMP products on day 45 with the premixed LAMP reagent supplemented with sucrose and stored at room temperature. The following apply to all panels; 1–6: Rat kidney samples confirmed for negative leptospiral DNA. 7–12: Rat kidney samples confirmed positive for leptospiral DNA. (i) Colorimetric observation based on the change in the color of calcein dye. (ii) Fluorescence emission under UV light. (iii) Electrophoresis of LAMP products in 1.5% agarose gel at 90 V for 45 min with ethidium bromide staining. Yellow boxes indicate positive LAMP amplification where calcein dye changes from orange to yellow–green, emission of fluorescence, and ladder-like bands. Products in the gel are visualized at 254 nm using a UV Transilluminator 2000 (Bio-Rad). A positive amplification in LAMP is indicated by the formation of ladder-like bands. No size marker was used on the gel as identification of a single discrete band is not possible with LAMP. All images are representative of at least 3 replicate experiments. LAMP, loop-mediated isothermal amplification; NC, nontemplate control; TC, Template control; UV, ultraviolet.
LAMP products on day 45 with the premixed LAMP reagent supplemented with sucrose and stored at room temperature. The following apply to all panels; 1–6: Rat kidney samples confirmed for negative leptospiral DNA. 7–12: Rat kidney samples confirmed positive for leptospiral DNA. (i) Colorimetric observation based on the change in the color of calcein dye. (ii) Fluorescence emission under UV light. (iii) Electrophoresis of LAMP products in 1.5% agarose gel at 90 V for 45 min with ethidium bromide staining. Yellow boxes indicate positive LAMP amplification where calcein dye changes from orange to yellow–green, emission of fluorescence, and ladder-like bands. Products in the gel are visualized at 254 nm using a UV Transilluminator 2000 (Bio-Rad). A positive amplification in LAMP is indicated by the formation of ladder-like bands. No size marker was used on the gel as identification of a single discrete band is not possible with LAMP. All images are representative of at least 3 replicate experiments. LAMP, loop-mediated isothermal amplification; NC, nontemplate control; TC, Template control; UV, ultraviolet.

LAMP primer sequences for secY of Leptospira

Primer Sequence (5′ – 3′)
F3 CTTGTTCCTGCCCTTCAAA
B3 TTCGGTGATCTGTTCTCCT
FIP TTCCGTGCCGGTAGACCA-GAACCGTAATTCTTTGTGCG
BIP CTTGAGCCTGCGCGTTAC-AATGAGAAGAACGGTTCCG
LF GCGAGTTGGATCACTGCTA
LB CCGGGCTTAATCAATTCTTCTG
Sprache:
Englisch
Zeitrahmen der Veröffentlichung:
6 Hefte pro Jahr
Fachgebiete der Zeitschrift:
Medizin, Gesundheitsfachberufe, Vorklinische Medizin, Grundlagenmedizin, Vorklinische Medizin, Grundlagenmedizin, andere, Klinische Medizin, Klinische Medizin, andere
Zeitschrift RSS Feed