Open Access

Echinacea purpurea extract (cichoric acid) exerts an anti-inflammatory effect on yak PBMCs and regulates the TLR4 signalling pathway

Cai-hua Xue

Cai-hua Xue

College of Agriculture and Animal Husbandry, Qinghai University, XiningQinghai Province, People’s Republic of China
Search for this author on
Sciendo|Google Scholar
Xue, Cai-hua
, 
Shun-xian A

Shun-xian A

College of Agriculture and Animal Husbandry, Qinghai University, XiningQinghai Province, People’s Republic of China
Search for this author on
Sciendo|Google Scholar
A, Shun-xian
, 
Meng-jie Wang

Meng-jie Wang

College of Agriculture and Animal Husbandry, Qinghai University, XiningQinghai Province, People’s Republic of China
Search for this author on
Sciendo|Google Scholar
Wang, Meng-jie
, 
Qiang Wu

Qiang Wu

College of Agriculture and Animal Husbandry, Qinghai University, XiningQinghai Province, People’s Republic of China
Search for this author on
Sciendo|Google Scholar
Wu, Qiang
, 
Jia-hua Liu

Jia-hua Liu

College of Agriculture and Animal Husbandry, Qinghai University, XiningQinghai Province, People’s Republic of China
Search for this author on
Sciendo|Google Scholar
Liu, Jia-hua
, 
Long-fei Zhang

Long-fei Zhang

College of Agriculture and Animal Husbandry, Qinghai University, XiningQinghai Province, People’s Republic of China
Search for this author on
Sciendo|Google Scholar
Zhang, Long-fei
, 
Yun Wu

Yun Wu

College of Agronomy and Biotechnology, Zun Normal College, ZunyiGuizhou Province, People’s Republic of China
Search for this author on
Sciendo|Google Scholar
Wu, Yun
, 
Hua Wu

Hua Wu

  • State Key Laboratory of Plateau Ecology and Agriculture, Qinghai University, XiningQinghai Province, People’s Republic of China
  • College of Agriculture and Animal Husbandry, Qinghai University, XiningQinghai Province, People’s Republic of China
Search for this author on
Sciendo|Google Scholar
Wu, Hua
 and 
Sha-tuo Chai

Sha-tuo Chai

College of Animal Science and Veterinary Medicine, Qinghai University, XiningQinghai Province, People’s Republic of China
Search for this author on
Sciendo|Google Scholar
Chai, Sha-tuo
  
Mar 09, 2021
Echinacea purpurea extract (cichoric acid) exerts an anti-inflammatory effect on yak PBMCs and regulates the TLR4 signalling pathway's Cover Image
About this article
Previous Article
Next Article
Cite
Download Cover
Published Online: Mar 09, 2021
Page range: 109 - 115
Received: Jul 06, 2020
Accepted: Feb 23, 2021
DOI: https://doi.org/10.2478/jvetres-2021-0016
Keywords
© 2021 C.H. Xue et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Effects of LPS on the survival rate of yak PBMCs. The survival rate was determined using a CCK-8. The values presented are the means ± SD. * – P < 0.05; ** – P < 0.01. P values are compared with the control group
Effects of LPS on the survival rate of yak PBMCs. The survival rate was determined using a CCK-8. The values presented are the means ± SD. * – P < 0.05; ** – P < 0.01. P values are compared with the control group

Fig. 2

Effects of LPS and CA on the survival rate of yak PBMCs. The survival rate was determined using a CCK-8. The values presented are the means ± SD. * – P < 0.05; ** – P < 0.01. P values are compared with the control group
Effects of LPS and CA on the survival rate of yak PBMCs. The survival rate was determined using a CCK-8. The values presented are the means ± SD. * – P < 0.05; ** – P < 0.01. P values are compared with the control group

Fig. 3

Effects of CA on the content of inflammatory-related factors in yak PBMCs. Cells were induced by 1μg/mL LPS, 60μg/mL CA, and 60μg/mL CA + 1μg/mL LPS for 48h. IL-6, IL-8, IL-1β, IFN-γ, TNF-α and IL-10 secretion of PBMCs in yak was detected by ELISA. * – P < 0.05; ** – P < 0.01. P values are compared with the control group. # – P < 0.05; ## –P < 0.01. P values are compared with the LPS group
Effects of CA on the content of inflammatory-related factors in yak PBMCs. Cells were induced by 1μg/mL LPS, 60μg/mL CA, and 60μg/mL CA + 1μg/mL LPS for 48h. IL-6, IL-8, IL-1β, IFN-γ, TNF-α and IL-10 secretion of PBMCs in yak was detected by ELISA. * – P < 0.05; ** – P < 0.01. P values are compared with the control group. # – P < 0.05; ## –P < 0.01. P values are compared with the LPS group

Fig. 4

Effects of CA on inflammatory factor mRNA expression of yak PBMCs. Cells were induced by 1μg/mL LPS, 60μg/mL CA, and 60μg/mL CA + 1μg/mL LPS for 48h. The RNA expression of IL-6, IL-8, IL-1β, IFN-γ, TNF-α and IL-10 was measured. * – P < 0.05; ** – P <0.01. P values are compared with the control group. # –P < 0.05; ## –P < 0.01. P values are compared with the LPS group
Effects of CA on inflammatory factor mRNA expression of yak PBMCs. Cells were induced by 1μg/mL LPS, 60μg/mL CA, and 60μg/mL CA + 1μg/mL LPS for 48h. The RNA expression of IL-6, IL-8, IL-1β, IFN-γ, TNF-α and IL-10 was measured. * – P < 0.05; ** – P <0.01. P values are compared with the control group. # –P < 0.05; ## –P < 0.01. P values are compared with the LPS group

Fig. 5

Effect of CA on the TLR4 signalling pathway in yak PBMCs. A– Expression of MyD88, NF-κB, TRAF6 and IRF5 mRNA detected by RT-PCR. * – P < 0.05; ** – P < 0.01. P values are compared with the control group. # – P < 0.05; ## – P < 0.01. P values are compared with the LPS group. B – SDS-PAGE electrophoresis diagram of key factors of the TLR4 pathway in yak PBMCs. C – Protein expression of MyD88, NF-κB, TRAF6 and IRF5 detected by Western blotting analysis. Cells were induced by 1μg/mL LPS, 60μg/mL CA, and 60μg/mL CA + 1μg/mL LPS for 48h. * – P < 0.05; ** – P < 0.01. P values are compared with the control group. # – P < 0.05; ## – P < 0.01. P values are compared with the LPS group
Effect of CA on the TLR4 signalling pathway in yak PBMCs. A– Expression of MyD88, NF-κB, TRAF6 and IRF5 mRNA detected by RT-PCR. * – P < 0.05; ** – P < 0.01. P values are compared with the control group. # – P < 0.05; ## – P < 0.01. P values are compared with the LPS group. B – SDS-PAGE electrophoresis diagram of key factors of the TLR4 pathway in yak PBMCs. C – Protein expression of MyD88, NF-κB, TRAF6 and IRF5 detected by Western blotting analysis. Cells were induced by 1μg/mL LPS, 60μg/mL CA, and 60μg/mL CA + 1μg/mL LPS for 48h. * – P < 0.05; ** – P < 0.01. P values are compared with the control group. # – P < 0.05; ## – P < 0.01. P values are compared with the LPS group

Gene primer sequences

Gene Forward primer Reverse primer
GAPDH ATCTGACCTGCCGCCTGGAG GACGCCTGCTTCACCACCTTC
INF-γ CCGAGCGTGGAGGATCATTGC CCAACGAGGCACAGCAGGATG
TNF-α CTGGCGGAGGAGGTGCTCTC GGAGGAAGGAGAAGAGGCTGAGG
IL-10 ACCAGCCACCAATGTTGCTCATAC CTTCTCCACCGCCTTGCTCTTG
IL-6 CACTGACCTGCTGGAGAAGATGC CCGAATAGCTCTCAGGCTGAACTG
IL-1β GAGTGCCATCCTTCTGTCAAGTCC AGCCTACCAAGCTCCTCCATCC
IL-8 CATGGATGGAGGAGCCTGGTAGG CTGCTAAGTCGCTTCAGTCGTGTC
NF-κB ACAAGCCTGTCACAGCCAACATG TGATGGTGAAGGCTCAGGAGGTG
IRF5 TGCTGCCTCTGACCGACCTG CGCACTTGCTCCAGGCTCAC
MyD88 TATCGGCTGAAGTTGTGCGTGTC TCAGAGACCACCACCACCATCC
Language:
English
Publication timeframe:
4 times per year
Journal Subjects:
Life Sciences, Molecular Biology, Microbiology and Virology, Life Sciences, other, Medicine, Veterinary Medicine
Journal RSS Feed