Acceso abierto

Echinacea purpurea extract (cichoric acid) exerts an anti-inflammatory effect on yak PBMCs and regulates the TLR4 signalling pathway

, , , , , , ,  y   
09 mar 2021

Cite
Descargar portada

Fig. 1

Effects of LPS on the survival rate of yak PBMCs. The survival rate was determined using a CCK-8. The values presented are the means ± SD. * – P < 0.05; ** – P < 0.01. P values are compared with the control group
Effects of LPS on the survival rate of yak PBMCs. The survival rate was determined using a CCK-8. The values presented are the means ± SD. * – P < 0.05; ** – P < 0.01. P values are compared with the control group

Fig. 2

Effects of LPS and CA on the survival rate of yak PBMCs. The survival rate was determined using a CCK-8. The values presented are the means ± SD. * – P < 0.05; ** – P < 0.01. P values are compared with the control group
Effects of LPS and CA on the survival rate of yak PBMCs. The survival rate was determined using a CCK-8. The values presented are the means ± SD. * – P < 0.05; ** – P < 0.01. P values are compared with the control group

Fig. 3

Effects of CA on the content of inflammatory-related factors in yak PBMCs. Cells were induced by 1μg/mL LPS, 60μg/mL CA, and 60μg/mL CA + 1μg/mL LPS for 48h. IL-6, IL-8, IL-1β, IFN-γ, TNF-α and IL-10 secretion of PBMCs in yak was detected by ELISA. * – P < 0.05; ** – P < 0.01. P values are compared with the control group. # – P < 0.05; ## –P < 0.01. P values are compared with the LPS group
Effects of CA on the content of inflammatory-related factors in yak PBMCs. Cells were induced by 1μg/mL LPS, 60μg/mL CA, and 60μg/mL CA + 1μg/mL LPS for 48h. IL-6, IL-8, IL-1β, IFN-γ, TNF-α and IL-10 secretion of PBMCs in yak was detected by ELISA. * – P < 0.05; ** – P < 0.01. P values are compared with the control group. # – P < 0.05; ## –P < 0.01. P values are compared with the LPS group

Fig. 4

Effects of CA on inflammatory factor mRNA expression of yak PBMCs. Cells were induced by 1μg/mL LPS, 60μg/mL CA, and 60μg/mL CA + 1μg/mL LPS for 48h. The RNA expression of IL-6, IL-8, IL-1β, IFN-γ, TNF-α and IL-10 was measured. * – P < 0.05; ** – P <0.01. P values are compared with the control group. # –P < 0.05; ## –P < 0.01. P values are compared with the LPS group
Effects of CA on inflammatory factor mRNA expression of yak PBMCs. Cells were induced by 1μg/mL LPS, 60μg/mL CA, and 60μg/mL CA + 1μg/mL LPS for 48h. The RNA expression of IL-6, IL-8, IL-1β, IFN-γ, TNF-α and IL-10 was measured. * – P < 0.05; ** – P <0.01. P values are compared with the control group. # –P < 0.05; ## –P < 0.01. P values are compared with the LPS group

Fig. 5

Effect of CA on the TLR4 signalling pathway in yak PBMCs. A– Expression of MyD88, NF-κB, TRAF6 and IRF5 mRNA detected by RT-PCR. * – P < 0.05; ** – P < 0.01. P values are compared with the control group. # – P < 0.05; ## – P < 0.01. P values are compared with the LPS group. B – SDS-PAGE electrophoresis diagram of key factors of the TLR4 pathway in yak PBMCs. C – Protein expression of MyD88, NF-κB, TRAF6 and IRF5 detected by Western blotting analysis. Cells were induced by 1μg/mL LPS, 60μg/mL CA, and 60μg/mL CA + 1μg/mL LPS for 48h. * – P < 0.05; ** – P < 0.01. P values are compared with the control group. # – P < 0.05; ## – P < 0.01. P values are compared with the LPS group
Effect of CA on the TLR4 signalling pathway in yak PBMCs. A– Expression of MyD88, NF-κB, TRAF6 and IRF5 mRNA detected by RT-PCR. * – P < 0.05; ** – P < 0.01. P values are compared with the control group. # – P < 0.05; ## – P < 0.01. P values are compared with the LPS group. B – SDS-PAGE electrophoresis diagram of key factors of the TLR4 pathway in yak PBMCs. C – Protein expression of MyD88, NF-κB, TRAF6 and IRF5 detected by Western blotting analysis. Cells were induced by 1μg/mL LPS, 60μg/mL CA, and 60μg/mL CA + 1μg/mL LPS for 48h. * – P < 0.05; ** – P < 0.01. P values are compared with the control group. # – P < 0.05; ## – P < 0.01. P values are compared with the LPS group

Gene primer sequences

Gene Forward primer Reverse primer
GAPDH ATCTGACCTGCCGCCTGGAG GACGCCTGCTTCACCACCTTC
INF-γ CCGAGCGTGGAGGATCATTGC CCAACGAGGCACAGCAGGATG
TNF-α CTGGCGGAGGAGGTGCTCTC GGAGGAAGGAGAAGAGGCTGAGG
IL-10 ACCAGCCACCAATGTTGCTCATAC CTTCTCCACCGCCTTGCTCTTG
IL-6 CACTGACCTGCTGGAGAAGATGC CCGAATAGCTCTCAGGCTGAACTG
IL-1β GAGTGCCATCCTTCTGTCAAGTCC AGCCTACCAAGCTCCTCCATCC
IL-8 CATGGATGGAGGAGCCTGGTAGG CTGCTAAGTCGCTTCAGTCGTGTC
NF-κB ACAAGCCTGTCACAGCCAACATG TGATGGTGAAGGCTCAGGAGGTG
IRF5 TGCTGCCTCTGACCGACCTG CGCACTTGCTCCAGGCTCAC
MyD88 TATCGGCTGAAGTTGTGCGTGTC TCAGAGACCACCACCACCATCC