Open Access

Influence of hydrogen-rich saline on hepatocyte autophagy during laparoscopic liver ischaemia-reperfusion combined resection injury in miniature pigs

Ge Bai
Ge Bai
, 
Hui Li
Hui Li
, 
Yansong Ge
Yansong Ge
, 
Qianzhen Zhang
Qianzhen Zhang
, 
Jiantao Zhang
Jiantao Zhang
, 
Mingzi Chen
Mingzi Chen
, 
Tao Liu
Tao Liu
 and 
Hongbin Wang
Hongbin Wang
   | Oct 23, 2018
Journal of Veterinary Research's Cover Image
About this article
Previous Article
Next Article
Cite
Published Online: Oct 23, 2018
Page range: 395 - 403
Received: Mar 22, 2018
Accepted: Aug 22, 2018
DOI: https://doi.org/10.2478/jvetres-2018-0056
Keywords
© 2018 G. Bai et al. published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Levels of ALT (A), AST (B), and AKP (C) in serum. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group
Levels of ALT (A), AST (B), and AKP (C) in serum. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group

Fig. 2

Levels of MDA (A), CAT (B), GSH (C), and SOD (D) in liver tissue. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group
Levels of MDA (A), CAT (B), GSH (C), and SOD (D) in liver tissue. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group

Fig. 3

Liver cells. A – sham group (10,000×); B – sham group (12,000×); C – IRI group (10,000×); D – IRI group (12,000×); E – IRI + HRS group (10,000×); F – IRI + HRS group (12,000×); N – nuclei; M – mitochondria; black arrows indicate endoplasmic reticulum and white arrows indicate the Golgi apparatus
Liver cells. A – sham group (10,000×); B – sham group (12,000×); C – IRI group (10,000×); D – IRI group (12,000×); E – IRI + HRS group (10,000×); F – IRI + HRS group (12,000×); N – nuclei; M – mitochondria; black arrows indicate endoplasmic reticulum and white arrows indicate the Golgi apparatus

Fig. 4

Expression levels of Beclin1 (A), mTOR (B), p62 (C), ATG5 (D), and ATG12 (E) in the liver. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group
Expression levels of Beclin1 (A), mTOR (B), p62 (C), ATG5 (D), and ATG12 (E) in the liver. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group

Fig. 5

Expression levels of Beclin1 (A), LC3B (B), and p62 (C) proteins in the three groups measured by Western blot. (D) Western blot results. Values are mean ±standard deviation. * Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group
Expression levels of Beclin1 (A), LC3B (B), and p62 (C) proteins in the three groups measured by Western blot. (D) Western blot results. Values are mean ±standard deviation. * Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group

Fig. 6

Liver. The results of IHC of LC3B at T3h; A and B – sham group; C and D – IRI group; E and F – IRI + HRS group. The images A, C, and E were recorded at 100× magnification, and the images B, D, and F were recorded at 400× magnification
Liver. The results of IHC of LC3B at T3h; A and B – sham group; C and D – IRI group; E and F – IRI + HRS group. The images A, C, and E were recorded at 100× magnification, and the images B, D, and F were recorded at 400× magnification

Primer sequences

GenePrimer sequence (5′-3′)
TCCATTACTTGCCACAGCCC (forward)
Beclin 1
CCCGATCAGAGTGAAGCTGT (reverse)
ACAAGGACACAGCGACTCAG (forward)
mTOR
CGCGGAACCAGTGAGGTAAT (reverse)
TACACGAGACCAGTCAACCTAAC (forward)
p62
AGAAGATGCTTGTGCCGAG (reverse)
GGTTTGAATATGAAGGCACACCA (forward)
ATG5
TGTGATGTTCCAAGGAAGAGCTG (reverse)
CAGAAACAGCCATCCCAGAG (forward)
ATG12
GCCTTCAGCAGGATGTCAAT (reverse)
TCTGGCAACCACACCTTCT (forward)
β-Actin
TGATCTGGGTCATCTTCTCAC (reverse)
eISSN:
2450-8608
Language:
English
Publication timeframe:
4 times per year
Journal Subjects:
Life Sciences, Molecular Biology, Microbiology and Virology, other, Medicine, Veterinary Medicine
Journal RSS Feed