Open Access

Influence of hydrogen-rich saline on hepatocyte autophagy during laparoscopic liver ischaemia-reperfusion combined resection injury in miniature pigs

, , , , , ,  and   
Oct 23, 2018

Cite
Download Cover

Fig. 1

Levels of ALT (A), AST (B), and AKP (C) in serum. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group
Levels of ALT (A), AST (B), and AKP (C) in serum. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group

Fig. 2

Levels of MDA (A), CAT (B), GSH (C), and SOD (D) in liver tissue. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group
Levels of MDA (A), CAT (B), GSH (C), and SOD (D) in liver tissue. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group

Fig. 3

Liver cells. A – sham group (10,000×); B – sham group (12,000×); C – IRI group (10,000×); D – IRI group (12,000×); E – IRI + HRS group (10,000×); F – IRI + HRS group (12,000×); N – nuclei; M – mitochondria; black arrows indicate endoplasmic reticulum and white arrows indicate the Golgi apparatus
Liver cells. A – sham group (10,000×); B – sham group (12,000×); C – IRI group (10,000×); D – IRI group (12,000×); E – IRI + HRS group (10,000×); F – IRI + HRS group (12,000×); N – nuclei; M – mitochondria; black arrows indicate endoplasmic reticulum and white arrows indicate the Golgi apparatus

Fig. 4

Expression levels of Beclin1 (A), mTOR (B), p62 (C), ATG5 (D), and ATG12 (E) in the liver. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group
Expression levels of Beclin1 (A), mTOR (B), p62 (C), ATG5 (D), and ATG12 (E) in the liver. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group

Fig. 5

Expression levels of Beclin1 (A), LC3B (B), and p62 (C) proteins in the three groups measured by Western blot. (D) Western blot results. Values are mean ±standard deviation. * Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group
Expression levels of Beclin1 (A), LC3B (B), and p62 (C) proteins in the three groups measured by Western blot. (D) Western blot results. Values are mean ±standard deviation. * Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group

Fig. 6

Liver. The results of IHC of LC3B at T3h; A and B – sham group; C and D – IRI group; E and F – IRI + HRS group. The images A, C, and E were recorded at 100× magnification, and the images B, D, and F were recorded at 400× magnification
Liver. The results of IHC of LC3B at T3h; A and B – sham group; C and D – IRI group; E and F – IRI + HRS group. The images A, C, and E were recorded at 100× magnification, and the images B, D, and F were recorded at 400× magnification

Primer sequences

GenePrimer sequence (5′-3′)
TCCATTACTTGCCACAGCCC (forward)
Beclin 1
CCCGATCAGAGTGAAGCTGT (reverse)
ACAAGGACACAGCGACTCAG (forward)
mTOR
CGCGGAACCAGTGAGGTAAT (reverse)
TACACGAGACCAGTCAACCTAAC (forward)
p62
AGAAGATGCTTGTGCCGAG (reverse)
GGTTTGAATATGAAGGCACACCA (forward)
ATG5
TGTGATGTTCCAAGGAAGAGCTG (reverse)
CAGAAACAGCCATCCCAGAG (forward)
ATG12
GCCTTCAGCAGGATGTCAAT (reverse)
TCTGGCAACCACACCTTCT (forward)
β-Actin
TGATCTGGGTCATCTTCTCAC (reverse)
Language:
English