Uneingeschränkter Zugang

Influence of hydrogen-rich saline on hepatocyte autophagy during laparoscopic liver ischaemia-reperfusion combined resection injury in miniature pigs

Ge Bai

Ge Bai

Heilongjiang Key Laboratory for Laboratory Animals and Comparative Medicine, College of Veterinary Medicine, Northeast Agricultural UniversityHarbin, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Bai, Ge
, 
Hui Li

Hui Li

Heilongjiang Key Laboratory for Laboratory Animals and Comparative Medicine, College of Veterinary Medicine, Northeast Agricultural UniversityHarbin, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Li, Hui
, 
Yansong Ge

Yansong Ge

Heilongjiang Key Laboratory for Laboratory Animals and Comparative Medicine, College of Veterinary Medicine, Northeast Agricultural UniversityHarbin, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Ge, Yansong
, 
Qianzhen Zhang

Qianzhen Zhang

Heilongjiang Key Laboratory for Laboratory Animals and Comparative Medicine, College of Veterinary Medicine, Northeast Agricultural UniversityHarbin, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Zhang, Qianzhen
, 
Jiantao Zhang

Jiantao Zhang

Heilongjiang Key Laboratory for Laboratory Animals and Comparative Medicine, College of Veterinary Medicine, Northeast Agricultural UniversityHarbin, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Zhang, Jiantao
, 
Mingzi Chen

Mingzi Chen

Heilongjiang Key Laboratory for Laboratory Animals and Comparative Medicine, College of Veterinary Medicine, Northeast Agricultural UniversityHarbin, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Chen, Mingzi
, 
Tao Liu

Tao Liu

Heilongjiang Key Laboratory for Laboratory Animals and Comparative Medicine, College of Veterinary Medicine, Northeast Agricultural UniversityHarbin, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Liu, Tao
 und 
Hongbin Wang

Hongbin Wang

Heilongjiang Key Laboratory for Laboratory Animals and Comparative Medicine, College of Veterinary Medicine, Northeast Agricultural UniversityHarbin, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Wang, Hongbin
  
23. Okt. 2018
Influence of hydrogen-rich saline on hepatocyte autophagy during laparoscopic liver ischaemia-reperfusion combined resection injury in miniature pigs's Cover Image
Über diesen Artikel
Vorheriger Artikel
Nächster Artikel
Zitieren
COVER HERUNTERLADEN
Online veröffentlicht: 23. Okt. 2018
Seitenbereich: 395 - 403
Eingereicht: 22. März 2018
Akzeptiert: 22. Aug. 2018
DOI: https://doi.org/10.2478/jvetres-2018-0056
Schlüsselwörter
© 2018 G. Bai et al. published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Levels of ALT (A), AST (B), and AKP (C) in serum. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group
Levels of ALT (A), AST (B), and AKP (C) in serum. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group

Fig. 2

Levels of MDA (A), CAT (B), GSH (C), and SOD (D) in liver tissue. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group
Levels of MDA (A), CAT (B), GSH (C), and SOD (D) in liver tissue. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group

Fig. 3

Liver cells. A – sham group (10,000×); B – sham group (12,000×); C – IRI group (10,000×); D – IRI group (12,000×); E – IRI + HRS group (10,000×); F – IRI + HRS group (12,000×); N – nuclei; M – mitochondria; black arrows indicate endoplasmic reticulum and white arrows indicate the Golgi apparatus
Liver cells. A – sham group (10,000×); B – sham group (12,000×); C – IRI group (10,000×); D – IRI group (12,000×); E – IRI + HRS group (10,000×); F – IRI + HRS group (12,000×); N – nuclei; M – mitochondria; black arrows indicate endoplasmic reticulum and white arrows indicate the Golgi apparatus

Fig. 4

Expression levels of Beclin1 (A), mTOR (B), p62 (C), ATG5 (D), and ATG12 (E) in the liver. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group
Expression levels of Beclin1 (A), mTOR (B), p62 (C), ATG5 (D), and ATG12 (E) in the liver. Values are mean ±standard deviation. *Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group

Fig. 5

Expression levels of Beclin1 (A), LC3B (B), and p62 (C) proteins in the three groups measured by Western blot. (D) Western blot results. Values are mean ±standard deviation. * Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group
Expression levels of Beclin1 (A), LC3B (B), and p62 (C) proteins in the three groups measured by Western blot. (D) Western blot results. Values are mean ±standard deviation. * Significant difference from sham group. # Significant difference of IRI + HRS group from IRI group

Fig. 6

Liver. The results of IHC of LC3B at T3h; A and B – sham group; C and D – IRI group; E and F – IRI + HRS group. The images A, C, and E were recorded at 100× magnification, and the images B, D, and F were recorded at 400× magnification
Liver. The results of IHC of LC3B at T3h; A and B – sham group; C and D – IRI group; E and F – IRI + HRS group. The images A, C, and E were recorded at 100× magnification, and the images B, D, and F were recorded at 400× magnification

Primer sequences

GenePrimer sequence (5′-3′)
TCCATTACTTGCCACAGCCC (forward)
Beclin 1
CCCGATCAGAGTGAAGCTGT (reverse)
ACAAGGACACAGCGACTCAG (forward)
mTOR
CGCGGAACCAGTGAGGTAAT (reverse)
TACACGAGACCAGTCAACCTAAC (forward)
p62
AGAAGATGCTTGTGCCGAG (reverse)
GGTTTGAATATGAAGGCACACCA (forward)
ATG5
TGTGATGTTCCAAGGAAGAGCTG (reverse)
CAGAAACAGCCATCCCAGAG (forward)
ATG12
GCCTTCAGCAGGATGTCAAT (reverse)
TCTGGCAACCACACCTTCT (forward)
β-Actin
TGATCTGGGTCATCTTCTCAC (reverse)
Sprache:
Englisch
Zeitrahmen der Veröffentlichung:
4 Hefte pro Jahr
Fachgebiete der Zeitschrift:
Biologie, Molekularbiologie, Mikrobiologie und Virologie, Biologie, andere, Medizin, Veterinärmedizin
Zeitschrift RSS Feed