Open Access

Influence of the genetic makeup of common carp on the expression of iron-related genes during Trypanoplasma borreli infection

Teresa Kamińska-Gibas

Teresa Kamińska-Gibas

Polish Academy of Sciences, Institute of Ichthyobiology and Aquaculture in GołyszChybie, Poland
Search for this author on
Sciendo|Google Scholar
Kamińska-Gibas, Teresa
, 
Ilgiz Irnazarow

Ilgiz Irnazarow

Polish Academy of Sciences, Institute of Ichthyobiology and Aquaculture in GołyszChybie, Poland
Search for this author on
Sciendo|Google Scholar
Irnazarow, Ilgiz
, 
Joanna Szczygieł

Joanna Szczygieł

Polish Academy of Sciences, Institute of Ichthyobiology and Aquaculture in GołyszChybie, Poland
Search for this author on
Sciendo|Google Scholar
Szczygieł, Joanna
 and 
Patrycja Jurecka

Patrycja Jurecka

Polish Academy of Sciences, Institute of Ichthyobiology and Aquaculture in GołyszChybie, Poland
Search for this author on
Sciendo|Google Scholar
Jurecka, Patrycja
  
Oct 23, 2018
Influence of the genetic makeup of common carp on the expression of iron-related genes during Trypanoplasma borreli infection's Cover Image
About this article
Previous Article
Next Article
Cite
Download Cover
Published Online: Oct 23, 2018
Page range: 285 - 290
Received: May 16, 2018
Accepted: Sep 18, 2018
DOI: https://doi.org/10.2478/jvetres-2018-0041
Keywords
© 2018 T. Kamińska-Gibas et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Common carp strain R3 (♦) and SA strain (■) mortality during Trypanoplasma borreli infection. Carp were infected with 2.6×105 of T. borreli
Common carp strain R3 (♦) and SA strain (■) mortality during Trypanoplasma borreli infection. Carp were infected with 2.6×105 of T. borreli

Fig. 2

Parasitaemia of common carp strain R3 (♦) and SA strain (■). Carp were infected with 2.6×105 of T. borreli. The values are means for blood samples from groups of n = 20 fish. Differences between carp strains are significant (P ≤ 0.05) for each time point except 0W
Parasitaemia of common carp strain R3 (♦) and SA strain (■). Carp were infected with 2.6×105 of T. borreli. The values are means for blood samples from groups of n = 20 fish. Differences between carp strains are significant (P ≤ 0.05) for each time point except 0W

Fig. 3

Serum iron concentration (μg dL-1) in strains R3 (■) and SA (■) during T. borreli infection. The values are means ±SD for blood samples from groups of n = 10 fish. Differences between the control group (not shown) and strains R3 and SA were considered significant for P ≤ 0.05 and marked with an asterisk
Serum iron concentration (μg dL-1) in strains R3 (■) and SA (■) during T. borreli infection. The values are means ±SD for blood samples from groups of n = 10 fish. Differences between the control group (not shown) and strains R3 and SA were considered significant for P ≤ 0.05 and marked with an asterisk

Fig. 4A

Transferrin receptor 1a expression in strain R3 (■) and SA (■) during Trypanoplasma borreli infection. Values after log transformation are expressed as a fold change ±SD relative to 40S (n = 5). Differences between the control group (not shown) and strains R3 and SA were considered significant for P ≤ 0.05 and marked with an asterisk. Differences between the strains were considered significant for P ≤ 0.05 in each time point and marked by a line
Transferrin receptor 1a expression in strain R3 (■) and SA (■) during Trypanoplasma borreli infection. Values after log transformation are expressed as a fold change ±SD relative to 40S (n = 5). Differences between the control group (not shown) and strains R3 and SA were considered significant for P ≤ 0.05 and marked with an asterisk. Differences between the strains were considered significant for P ≤ 0.05 in each time point and marked by a line

Fig. 4B

Transferrin receptor 1b expression in strain R3 (■) and SA (■) during Trypanoplasma borreli infection. Values after log transformation are expressed as a fold change ±SD relative to 40S ( n = 5). Differences between the control group (not shown) and strains R3 and SA were considered significant for P ≤ 0.05 and marked with an asterisk. Differences between strains were considered significant for P ≤ 0.05 and marked with the asterisks
Transferrin receptor 1b expression in strain R3 (■) and SA (■) during Trypanoplasma borreli infection. Values after log transformation are expressed as a fold change ±SD relative to 40S ( n = 5). Differences between the control group (not shown) and strains R3 and SA were considered significant for P ≤ 0.05 and marked with an asterisk. Differences between strains were considered significant for P ≤ 0.05 and marked with the asterisks

Fig. 4C

Ferritin expression in strain R3 (■) and SA (■) during Trypanoplasma borreli infection. Values after log transformation are expressed as a fold change SD relative to 40S (n = 5). Differences between the control group (not shown) and strains R3 and SA were considered significant for P ≤ 0.05 and marked with an asterisk. Differences between strains were considered significant for P ≤ 0.05 in each time point and marked by a line
Ferritin expression in strain R3 (■) and SA (■) during Trypanoplasma borreli infection. Values after log transformation are expressed as a fold change SD relative to 40S (n = 5). Differences between the control group (not shown) and strains R3 and SA were considered significant for P ≤ 0.05 and marked with an asterisk. Differences between strains were considered significant for P ≤ 0.05 in each time point and marked by a line

Fig. 4D

Transferrin expression in strain R3 (■) and SA (■) during Trypanoplasmaborreli infection. Values after log transformation are expressed as a fold change ±SD relative to 40S (n = 5). Differences between the control group (not shown) and strains R3 and SA were considered significant for P ≤ 0.05 and marked with an asterisk. Differences between strains were considered significant for P ≤ 0.05 and marked with the asterisks
Transferrin expression in strain R3 (■) and SA (■) during Trypanoplasmaborreli infection. Values after log transformation are expressed as a fold change ±SD relative to 40S (n = 5). Differences between the control group (not shown) and strains R3 and SA were considered significant for P ≤ 0.05 and marked with an asterisk. Differences between strains were considered significant for P ≤ 0.05 and marked with the asterisks

qRT–PCR primers used in this study

GenePrimerSequence (5'–3')
TfR1aFTCATACCCAGTTTCCCCCAG
RGGTATCCCGAAGCATCCCAT
TfR1bFGAGCTGGAAAAATCAGCATGG
RGGAATCCTGGGGTGTAAGGA
TfFCCCTCAGCCAGTGCTCAAAA
RATAGCATCTGCATCACCAGTC
FerFTGGAGCTGTATGCATCCTACG
RCCCTCCCCTCTGGTTCTGA
40SFCCGTGGGTGACATCGTTACA
RTCAGGACATTGAACCTCACTGTCT
Language:
English
Publication timeframe:
4 times per year
Journal Subjects:
Life Sciences, Molecular Biology, Microbiology and Virology, Life Sciences, other, Medicine, Veterinary Medicine
Journal RSS Feed