Genome Characterization and Development of Real-Time PCR Assays for  and

Ekaterina Ponomareva; Ahmed Badiss; Tahera Sultana; Qing Yu; Hai D.T. Nguyen

Open Access

Genome Characterization and Development of Real-Time PCR Assays for Ditylenchus dipsaci and D. weischeri

and

| Feb 01, 2023

Journal of Nematology

Volume 54 (2022): Issue 1 (February 2022)

About this article

Cite

Published Online: Feb 01, 2023

Page range: -

Received: Aug 08, 2022

DOI: https://doi.org/10.2478/jofnem-2022-0058

Keywords
detection, genomics, Illumina sequencing, Nanopore sequencing, real-time PCR, stem and bulb nematode

© 2022 Walter de Gruyter GmbH, Berlin/Boston

This work is licensed under the Creative Commons Attribution 4.0 International License.

Representative standard curves for Ditylenchus dipsaci primer-probe sets for orthogroups OG0014442 and OG0014782. Average amplification efficiencies (SE) based on three replicate real-time PCR runs were 95.9% (1.88) and 97.0% (2.33), respectively.

Representative standard curves for Ditylenchus weischeri primer-probe sets for orthogroups OG0018807 and OG0020570. Average amplification efficiencies (SE) based on three real-time PCR runs were 100.2% (3.05) and 98.0% (3.97), respectively.

Influence of the number of nematodes used for DNA extraction on the quantification cycle (Cq) values in Ditylenchus dipsaci and D. weischeri real-time PCR assays, showing the mean Cq values ± SD.

Species	Number of nematodes	D. dipsaci (OG0014442)	D. dipsaci (OG0014782)	D. weischeri (OG0018807)	D. weischeri (OG0020570)
D. E-105 dipsaci	10 nematodes	29.12 ± 0.22	27.93 ± 0.13	ND	ND
	5 nematodes	31.24 ± 0.74	29.98 ± 1.21	ND	ND
	1 nematode	32.40 ± 1.79	32.57 ± 1.76	ND	ND
D. S-100 weischeri	10 nematodes	ND	ND	28.94 ± 0.18	29.80 ± 0.57
	5 nematodes	ND	ND	30.20 ± 0.61	31.29 ± 0.55
	1 nematode	ND	ND	32.98 ± 1.78	34.21 ± 1.84

Nematode isolates used for real-time PCR in this study.

Species	Strain name	Host	Origin
Ditylenchus dipsaci	C-100	Garlic	Clemson, USA
Ditylenchus dipsaci	E-105	Garlic	Ontario, Canada
Ditylenchus dipsaci	G-137	Garlic	Ontario, Canada
Ditylenchus weischeri	O-100	Creeping thistle	Ontario, Canada
Ditylenchus weischeri	S-100	Creeping thistle	Saskatchewan, Canada
Ditylenchus destructor	J-100	Sweet potato	Jiangsu, China
Ditylenchus destructor	O-101	Garlic	Ontario, Canada
Ditylenchus africanus	D-afri-South-Afr	Unknown	South Africa
Ditylenchus sp.	Dity-sp-Jord-ONT	Turf	Ontario, Canada
Litylenchus crenatae	Lity-cren-ONT-01	Beech tree leaf	Ontario, Canada

Real-Time PCR primers and probes developed for D. dipsaci and D. weischeri.

Species	Orthogroup ID	Primer or probe name	Sequence (5 -3)	Optimized final concentration (nM)	Product size (bp)
Ditylenchus dipsaci	OG0014442	Dp-OG0014442-F	TCCTGCTCCACTATCAACACTTC	100	108
		Dp-OG0014442-R	CAGACGATAAGCTTGTTCATTGGA	800
		Dp-OG0014442-P	TGGTCGTTATATGCTCAGCAAGGGAATGC	100
	OG0014782	Dp-OG0014782-F	CATTAGATCGTGTAGCTTGCGAG	200	122
		Dp-OG0014782-R	AGCCATCCAATTGATCGATCGTA	800
		Dp-OG0014782-P	AGGGATCTGACAGAATTCGACTACCGCA	100
Dityienchus weischeri	OG0018807	Dw-OG0018807-F	GCCCGACGAGCTATTATTATCAC	100	137
		Dw-OG0018807-R	GTAGAGGCTTTCATCCTGACCAA	800
		Dw-OG0018807-P	TTGAGAATGAGTCCCACTACAACGCCCA	100
	OG0020570	DW-OG0020570-F	AACGGAGAAGTCAGTCAAGTTGT	100	125
		DW-OG0020570-R	ATTCCTCATGCGTGAATTTCAGC	400
		DW-OG0020570-P	AATCTTCCACAATCGCTGCGCAATCCT	100

Genome statistics for Ditylenchus dipsaci and D. weischeri.

Sample	Estimated sequencing coverage	No. of contigs	Largest contig (bp)	Total length (Mb)	GC (%)	N50 (bp)	L50	No. of gaps per 100 kb	No. of genes predicted	No. of complete BUSCOs
D. dipsaci C-100	118	2,256	1,471,657	228.2	37.5	227,010	265	0	24,896	2,025 (64.7%)
D. dipsaci E-105s	42	1,394	3,685,767	227.2	37.5	287,390	200	2.28	24,931	1,555 (49.7%)
D. dipsaci G-137	93	5,530	716,842	239.5	37.5	84,485	809	0	27,365	1,952 (62.4%)
D. weischeri 0-100	113	1,715	878,229	177.0	37.8	169,855	311	0	21,403	1,743 (55.7%)
D. weischeri S-100	129	2,012	1,555,244	196.3	37.9	192,952	282	0	25,930	1,816 (58.0%)

Ditylenchus dipsaci and D. weischeri real-time PCR assay results with the mean quantification cycle (Cq) values ± SD.

Species	Input DNA	D. dipsaci (OG0014442)	D. dipsaci (OG0014782)	D. weischeri (OG0018807)	D. weischeri (OG0020570)
D. dipsaci C-100	~1 ng/ul	26.42 ± 0.04	27.22 ± 0.05	–	–
D. dipsaci E-105	~1 ng/ul	26.08 ± 0.17	25.91 ± 0.08	–	–
D. dipsaci G-137	~1 ng/ul	25.16 ± 0.07	24.29 ± 0.03	–	–
D. weischeri O-100	~1 ng/ul	–	–	25.05 ± 0.03	25.15 ± 0.05
D. weischeri S-100	~1 ng/ul	–	–	25.26 ± 0.04	25.53 ± 0.05
D. destructor J-100	~1 ng/ul	–	36.74 ± 0.47	–	–
D. destructor O-101	~1 ng/ul	35.08 ± 1.55	37.59 ± 1.47	–	–
D. D-afri-africanus South-Afr	5 nematodes	–	–	–	–
Ditylenchus Dity-sp-Jord-sp. ONT	5 nematodes	–	–	–	–
Litylenchus crenatae Lity-cren-ONT-01	1 or 10 nematodes	–	–	–	–
D. D. dipsaci weischeri + pooled	~1 ng/ul	27.25 ± 0.06	26.88 ± 0.01	26.48 ± 0.07	26.45 ± 0.25
D. dipsaci + D. destructor pooled	~1 ng/ul	27.55 ± 0.03	27.07 ± 0.08	–	–
D. weischeri + D. destructor pooled	~1 ng/ul	37.62 ± 0.21	38.055 ± 0.46	26.64 ± 0.14	26.86 ± 0.05
D. dipsaci + D. weischeri + D. destructor pooled	∼1 ng/ul	27.88 ± 0.06	27.5 ± 0.03	26.87 ± 0.04	26.97 ± 0.03

eISSN:: 2640-396X
Language:: English

Publication timeframe:: Volume Open
Journal Subjects:: Life Sciences, other

Journal RSS Feed

Genome Characterization and Development of Real-Time PCR Assays for Ditylenchus dipsaci and D. weischeri

Article Category: Research Paper

Published Online: Feb 01, 2023

Page range: -

Received: Aug 08, 2022

DOI: https://doi.org/10.2478/jofnem-2022-0058

Keywords
detection, genomics, Illumina sequencing, Nanopore sequencing, real-time PCR, stem and bulb nematode

© 2022 Walter de Gruyter GmbH, Berlin/Boston

This work is licensed under the Creative Commons Attribution 4.0 International License.

Figure 1

Figure 2

Influence of the number of nematodes used for DNA extraction on the quantification cycle (Cq) values in Ditylenchus dipsaci and D. weischeri real-time PCR assays, showing the mean Cq values ± SD.

Nematode isolates used for real-time PCR in this study.

Real-Time PCR primers and probes developed for D. dipsaci and D. weischeri.

Genome statistics for Ditylenchus dipsaci and D. weischeri.

Ditylenchus dipsaci and D. weischeri real-time PCR assay results with the mean quantification cycle (Cq) values ± SD.

Genome Characterization and Development of Real-Time PCR Assays for Ditylenchus dipsaci and D. weischeri

Article Category: Research Paper

Published Online: Feb 01, 2023

Page range: -

Received: Aug 08, 2022

DOI: https://doi.org/10.2478/jofnem-2022-0058

Keywordsdetection, genomics, Illumina sequencing, Nanopore sequencing, real-time PCR, stem and bulb nematode

© 2022 Walter de Gruyter GmbH, Berlin/Boston

This work is licensed under the Creative Commons Attribution 4.0 International License.

Figure 1

Figure 2

Influence of the number of nematodes used for DNA extraction on the quantification cycle (Cq) values in Ditylenchus dipsaci and D. weischeri real-time PCR assays, showing the mean Cq values ± SD.

Nematode isolates used for real-time PCR in this study.

Real-Time PCR primers and probes developed for D. dipsaci and D. weischeri.

Genome statistics for Ditylenchus dipsaci and D. weischeri.

Ditylenchus dipsaci and D. weischeri real-time PCR assay results with the mean quantification cycle (Cq) values ± SD.

Keywords
detection, genomics, Illumina sequencing, Nanopore sequencing, real-time PCR, stem and bulb nematode