Open Access

Location and Strength of Malvolio Expression in Chinese Honeybee Reveals Its Potential Role in Labor Division

Weihua Ma

Weihua Ma

College of Animal Science, Shanxi Agricultural UniversityP.R.China
Search for this author on
Sciendo|Google Scholar
Ma, Weihua
, 
Jiao Meng

Jiao Meng

College of Animal Science, Shanxi Agricultural UniversityP.R.China
Search for this author on
Sciendo|Google Scholar
Meng, Jiao
, 
Xianyun Zhen

Xianyun Zhen

Institute of Environmental Science, Shanxi UniversityTaiyuan, P.R.China
Search for this author on
Sciendo|Google Scholar
Zhen, Xianyun
, 
Huiting Zhao

Huiting Zhao

College of Life Science, Shanxi Agricultural UniversityP.R.China
Search for this author on
Sciendo|Google Scholar
Zhao, Huiting
, 
Wanghong Li

Wanghong Li

School of Physical Exercise and Education, Shanxi UniversityTaiyuan, P.R.China
Search for this author on
Sciendo|Google Scholar
Li, Wanghong
, 
Ye Gao

Ye Gao

School of Physical Exercise and Education, Shanxi UniversityTaiyuan, P.R.China
Search for this author on
Sciendo|Google Scholar
Gao, Ye
 and 
YuSuo Jiang

YuSuo Jiang

College of Animal Science, Shanxi Agricultural UniversityP.R.China
Search for this author on
Sciendo|Google Scholar
Jiang, YuSuo
  
Apr 26, 2021
Location and Strength of Malvolio Expression in Chinese Honeybee Reveals Its Potential Role in Labor Division's Cover Image
About this article
Previous Article
Next Article
Cite
Download Cover
Article Category: Original Article
Published Online: Apr 26, 2021
Page range: 61 - 70
Received: Jun 07, 2019
Accepted: Dec 31, 2020
DOI: https://doi.org/10.2478/jas-2021-0004
Keywords
© 2021 Weihua Ma et al., published by Sciendo
This work is licensed under the Creative Commons Attribution 4.0 International License.

Fig. 1

Acmvl expression profile in age-marked worker bees. Bees were sampled at seven different time points separated by five-day intervals. Expression is relative to the value at day 30 (assigned the arbitrary value of one). Bars represent standard errors. Different letters indicate statistical differences.
Acmvl expression profile in age-marked worker bees. Bees were sampled at seven different time points separated by five-day intervals. Expression is relative to the value at day 30 (assigned the arbitrary value of one). Bars represent standard errors. Different letters indicate statistical differences.

Fig. 2

Acmvl protein production in the tissues of nurse, nectar forager and pollen forager A. c. cerana bees.A. The strip of Acmvl protein in four tissues. 1: Head (antennas included); 2: Thorax (wings included); 3: Abdomen; 4: Leg. β-actin was used as the internal control. B. The bar of Acmvl protein expression in three tissues. Image analysis was conducted using Image J. Bars represent the means of three independent experiments. Uppercase letters indicate differences between bee behavioral groups in protein production within the same tissue. Lowercase letters indicate differences between tissues within a behavioral group. Bars represent standard errors. Different letters represent statistical differences.
Acmvl protein production in the tissues of nurse, nectar forager and pollen forager A. c. cerana bees.A. The strip of Acmvl protein in four tissues. 1: Head (antennas included); 2: Thorax (wings included); 3: Abdomen; 4: Leg. β-actin was used as the internal control. B. The bar of Acmvl protein expression in three tissues. Image analysis was conducted using Image J. Bars represent the means of three independent experiments. Uppercase letters indicate differences between bee behavioral groups in protein production within the same tissue. Lowercase letters indicate differences between tissues within a behavioral group. Bars represent standard errors. Different letters represent statistical differences.

Fig. 3

Acmvl expression in pollen forager brains. Antennal lobes (AL); Kenyon cells (KC); Optic Lobes (OL).(A) Treatment group hybridized with antisense probe; dark yellow particles are positive signals. (B) Control group hybridized with the sense probe. B, C, and D depict positive signals in Kenyon cells of the mushroom body, optic lobes, and antennal lobes, respectively, while b, c, and d depict negative controls for the corresponding regions.
Acmvl expression in pollen forager brains. Antennal lobes (AL); Kenyon cells (KC); Optic Lobes (OL).(A) Treatment group hybridized with antisense probe; dark yellow particles are positive signals. (B) Control group hybridized with the sense probe. B, C, and D depict positive signals in Kenyon cells of the mushroom body, optic lobes, and antennal lobes, respectively, while b, c, and d depict negative controls for the corresponding regions.

Primer and Probe sequences of Acmvl and house gene 18S rRNA

Name for gene and probe Sequence
Acmvl Forward: TGCATACGTTCCTGTCATTGTGG
Reverse: AGGTGGCATATTTCTCGGTTGTG
18S rRNA Forward: CCCGTAATCGGAATGAGTACACTTT
Reverse: ACGCTATTGGAGCTGGAATTACC
Acmvl anti-sense probe CAAGAGTTACGAAGCCATCTCGACAAGTTT
CGCTGCCAATTGTCGAACAAGAGGGACAGA
GATTGCCAGCTATGGGCCATCGACCGACAA
Language:
English
Publication timeframe:
2 times per year
Journal Subjects:
Life Sciences, Zoology, Life Sciences, other
Journal RSS Feed