Acceso abierto

Location and Strength of Malvolio Expression in Chinese Honeybee Reveals Its Potential Role in Labor Division

Weihua Ma
Weihua Ma
, 
Jiao Meng
Jiao Meng
, 
Xianyun Zhen
Xianyun Zhen
, 
Huiting Zhao
Huiting Zhao
, 
Wanghong Li
Wanghong Li
, 
Ye Gao
Ye Gao
 y 
YuSuo Jiang
YuSuo Jiang
   | 26 abr 2021
Journal of Apicultural Science's Cover Image
Acerca de este artículo
Artículo anterior
Artículo siguiente
Cite
Article Category: Original Article
Publicado en línea: 26 abr 2021
Páginas: 61 - 70
Recibido: 07 jun 2019
Aceptado: 31 dic 2020
DOI: https://doi.org/10.2478/jas-2021-0004
Palabras clave
© 2021 Weihua Ma et al., published by Sciendo
This work is licensed under the Creative Commons Attribution 4.0 International License.

Fig. 1

Acmvl expression profile in age-marked worker bees. Bees were sampled at seven different time points separated by five-day intervals. Expression is relative to the value at day 30 (assigned the arbitrary value of one). Bars represent standard errors. Different letters indicate statistical differences.
Acmvl expression profile in age-marked worker bees. Bees were sampled at seven different time points separated by five-day intervals. Expression is relative to the value at day 30 (assigned the arbitrary value of one). Bars represent standard errors. Different letters indicate statistical differences.

Fig. 2

Acmvl protein production in the tissues of nurse, nectar forager and pollen forager A. c. cerana bees.A. The strip of Acmvl protein in four tissues. 1: Head (antennas included); 2: Thorax (wings included); 3: Abdomen; 4: Leg. β-actin was used as the internal control. B. The bar of Acmvl protein expression in three tissues. Image analysis was conducted using Image J. Bars represent the means of three independent experiments. Uppercase letters indicate differences between bee behavioral groups in protein production within the same tissue. Lowercase letters indicate differences between tissues within a behavioral group. Bars represent standard errors. Different letters represent statistical differences.
Acmvl protein production in the tissues of nurse, nectar forager and pollen forager A. c. cerana bees.A. The strip of Acmvl protein in four tissues. 1: Head (antennas included); 2: Thorax (wings included); 3: Abdomen; 4: Leg. β-actin was used as the internal control. B. The bar of Acmvl protein expression in three tissues. Image analysis was conducted using Image J. Bars represent the means of three independent experiments. Uppercase letters indicate differences between bee behavioral groups in protein production within the same tissue. Lowercase letters indicate differences between tissues within a behavioral group. Bars represent standard errors. Different letters represent statistical differences.

Fig. 3

Acmvl expression in pollen forager brains. Antennal lobes (AL); Kenyon cells (KC); Optic Lobes (OL).(A) Treatment group hybridized with antisense probe; dark yellow particles are positive signals. (B) Control group hybridized with the sense probe. B, C, and D depict positive signals in Kenyon cells of the mushroom body, optic lobes, and antennal lobes, respectively, while b, c, and d depict negative controls for the corresponding regions.
Acmvl expression in pollen forager brains. Antennal lobes (AL); Kenyon cells (KC); Optic Lobes (OL).(A) Treatment group hybridized with antisense probe; dark yellow particles are positive signals. (B) Control group hybridized with the sense probe. B, C, and D depict positive signals in Kenyon cells of the mushroom body, optic lobes, and antennal lobes, respectively, while b, c, and d depict negative controls for the corresponding regions.

Primer and Probe sequences of Acmvl and house gene 18S rRNA

Name for gene and probe Sequence
Acmvl Forward: TGCATACGTTCCTGTCATTGTGG
Reverse: AGGTGGCATATTTCTCGGTTGTG
18S rRNA Forward: CCCGTAATCGGAATGAGTACACTTT
Reverse: ACGCTATTGGAGCTGGAATTACC
Acmvl anti-sense probe CAAGAGTTACGAAGCCATCTCGACAAGTTT
CGCTGCCAATTGTCGAACAAGAGGGACAGA
GATTGCCAGCTATGGGCCATCGACCGACAA
eISSN:
2299-4831
Idioma:
Inglés
Calendario de la edición:
2 veces al año
Temas de la revista:
Life Sciences, Zoology, other
RSS Feed de revista