Open Access

Physiological role of Prion Protein in Copper homeostasis and angiogenic mechanisms of endothelial cells

Lidia De Riccardis

Lidia De Riccardis

Dept. of Biological and Environmental Science and Technology, University of SalentoLecce, Italy
Search for this author on
Sciendo|Google Scholar
De Riccardis, Lidia
, 
Francesca Rizzo

Francesca Rizzo

Dept. of Biological and Environmental Science and Technology, University of SalentoLecce, Italy
Search for this author on
Sciendo|Google Scholar
Rizzo, Francesca
, 
Emanuela Urso

Emanuela Urso

Dept. of Biological and Environmental Science and Technology, University of SalentoLecce, Italy
Search for this author on
Sciendo|Google Scholar
Urso, Emanuela
, 
Valeria Garzarelli

Valeria Garzarelli

Dept. of Biological and Environmental Science and Technology, University of SalentoLecce, Italy
Search for this author on
Sciendo|Google Scholar
Garzarelli, Valeria
, 
Vincenza Intini

Vincenza Intini

Dept. of Biological and Environmental Science and Technology, University of SalentoLecce, Italy
Search for this author on
Sciendo|Google Scholar
Intini, Vincenza
, 
Marco Greco

Marco Greco

Dept. of Biological and Environmental Science and Technology, University of SalentoLecce, Italy
Search for this author on
Sciendo|Google Scholar
Greco, Marco
, 
Maria Chiara Maffia

Maria Chiara Maffia

San Raffaele -Telethon Institute for Gene Therapy, Vita Salute San Raffaele UniversityMilan, Italy
Search for this author on
Sciendo|Google Scholar
Maffia, Maria Chiara
, 
Antonio Danieli

Antonio Danieli

Dept. of Biological and Environmental Science and Technology, University of SalentoLecce, Italy
Search for this author on
Sciendo|Google Scholar
Danieli, Antonio
 and 
Michele Maffia

Michele Maffia

  • Dept. of Biological and Environmental Science and Technology, University of SalentoLecce, Italy
  • Lab of Clinical Proteomic, “V. Fazzi” HospitalLecce, Italy
Search for this author on
Sciendo|Google Scholar
Maffia, Michele
  
Apr 24, 2019
Physiological role of Prion Protein in Copper homeostasis and angiogenic mechanisms of endothelial cells's Cover Image
About this article
Previous Article
Next Article
Cite
Download Cover
Article Category: Research Article
Published Online: Apr 24, 2019
Page range: 57 - 70
DOI: https://doi.org/10.2478/ebtj-2019-0007
Keywords
© 2019 Lidia De Riccardis, Francesca Rizzo, Emanuela Urso, Valeria Garzarelli, Vincenza Intini, Marco Greco, Maria Chiara Maffia, Antonio Danieli, Michele Maffia, published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Figure 1

Effect of transfection on cell viability. HUVEC cells seeded in 96 multi-well plates were transfected with the 30 nM siRNA/siPORT NeoFX complexes, using a variable amount of the lipid agent (0.15-75 μl). After 72h, cell viability was quantified by MTT test; experimental replicates n = 3. The ANOVA statistical test did not reveal significant differences between the measured average values.
Effect of transfection on cell viability. HUVEC cells seeded in 96 multi-well plates were transfected with the 30 nM siRNA/siPORT NeoFX complexes, using a variable amount of the lipid agent (0.15-75 μl). After 72h, cell viability was quantified by MTT test; experimental replicates n = 3. The ANOVA statistical test did not reveal significant differences between the measured average values.

Figure 2

Analysis of the PrP transcript levels. (a) Real Time PCR analysis of the PrP transcript levels was performed in total RNA samples extracted from control (ctrl) e transfected cells at 48h with siRNA s11212 e s11213, administered separately or simultaneously (siRNA mix, control internal: GADPH, experimental replicates n = 3). (b) Western blot analysis of prion protein levels performed on transfected cellular extracts at 48h (internal control: β -actin) (c).
Analysis of the PrP transcript levels. (a) Real Time PCR analysis of the PrP transcript levels was performed in total RNA samples extracted from control (ctrl) e transfected cells at 48h with siRNA s11212 e s11213, administered separately or simultaneously (siRNA mix, control internal: GADPH, experimental replicates n = 3). (b) Western blot analysis of prion protein levels performed on transfected cellular extracts at 48h (internal control: β -actin) (c).

Figure 3

Effect of PrPC protein expression on the copper-induced cytotoxicity profile. Control and PrPKD HUVEC cells were treated for 24h with increasing concentrations of copper. The percentage of viable cells, estimated by MTT assay, is compared to the control condition (no treatment). The EC50 (half maximal effective substrate concentration) values belong to each of the dose-response curves and were evaluated using GraphPad Prism 5.0 software; the values in the graph are reported as mean ± SE and were compared by Student’s t test (n = 3; ** p <0.01).
Effect of PrPC protein expression on the copper-induced cytotoxicity profile. Control and PrPKD HUVEC cells were treated for 24h with increasing concentrations of copper. The percentage of viable cells, estimated by MTT assay, is compared to the control condition (no treatment). The EC50 (half maximal effective substrate concentration) values belong to each of the dose-response curves and were evaluated using GraphPad Prism 5.0 software; the values in the graph are reported as mean ± SE and were compared by Student’s t test (n = 3; ** p <0.01).

Figure 4

Membrane Cu2+-reductase activity in HUVEC Ctrl and knockdown PrPKD. Copper ions accumulation in culture medium has been evaluated via colorimetric assay of the Cu/BCS complex (482 nm). Data are reported as mean ± SE (n=3; **p < 0.01).
Membrane Cu2+-reductase activity in HUVEC Ctrl and knockdown PrPKD. Copper ions accumulation in culture medium has been evaluated via colorimetric assay of the Cu/BCS complex (482 nm). Data are reported as mean ± SE (n=3; **p < 0.01).

Figure 5

Endocytosis inhibitors effect on the copper accumulation in the HUVEC cells. (a) HUVEC cells have been pre-treated with Cytochalasin B (Cyt B; 100 μg/ml), Chlorpromazine (CPZ; 50 μM), or exposed to hypertonic shock (Hyper) for 15 min, before being dyed with Phen Green SK fluorescent indicator and exposed to a Cu-His2 concentration of 20 μM. (b) Cytochalasin B scalar concentrations effect on the ion copper uptake (Cu-His2 20 μM; n=3, *p<0.05). (c) Cytochalasin B effect on the copper uptake in HUVEC Ctrl and PrPKD cells. (n=3; ANOVA, **p<0.01).
Endocytosis inhibitors effect on the copper accumulation in the HUVEC cells. (a) HUVEC cells have been pre-treated with Cytochalasin B (Cyt B; 100 μg/ml), Chlorpromazine (CPZ; 50 μM), or exposed to hypertonic shock (Hyper) for 15 min, before being dyed with Phen Green SK fluorescent indicator and exposed to a Cu-His2 concentration of 20 μM. (b) Cytochalasin B scalar concentrations effect on the ion copper uptake (Cu-His2 20 μM; n=3, *p<0.05). (c) Cytochalasin B effect on the copper uptake in HUVEC Ctrl and PrPKD cells. (n=3; ANOVA, **p<0.01).

Figure 6

Spheroid formation assay. Representative images showing Spheroids’ growth obtained from HUVEC PrPKD and scrambled siRNAs cells at 16, 24 and 48 h. Images were taken with a 20X objective.
Spheroid formation assay. Representative images showing Spheroids’ growth obtained from HUVEC PrPKD and scrambled siRNAs cells at 16, 24 and 48 h. Images were taken with a 20X objective.

Figure 7

Spheroid-derived cell vitality assay. Cells derived from control (Ctrl) and knockdown (PrPKD) spheroids mechanically detached and counted at the given timepoints have been dyed with Trypan Blue 0,2% in order to discriminate viable cells. The graph shows vitality percentage relative to the number of cultured cells counted in Ctrl spheroids after 16h. (n=3; *p < 0.05).
Spheroid-derived cell vitality assay. Cells derived from control (Ctrl) and knockdown (PrPKD) spheroids mechanically detached and counted at the given timepoints have been dyed with Trypan Blue 0,2% in order to discriminate viable cells. The graph shows vitality percentage relative to the number of cultured cells counted in Ctrl spheroids after 16h. (n=3; *p < 0.05).

Figure 8

VEGF-induced tubulogenesis assay in Matrigel. HUVEC control (a-b) and PrPKD (d-e) seeded on Matrigel and stimulated for 16h. Images (c) and (f ), relative to network analysis are performed by WimTube software (Wimasis GmbH, Germany). Histograms (g) are respectively referred to coverage area, tubules and knots; data reported are related to statistical analysis of images acquired in three independent experiments (* p <0.05).
VEGF-induced tubulogenesis assay in Matrigel. HUVEC control (a-b) and PrPKD (d-e) seeded on Matrigel and stimulated for 16h. Images (c) and (f ), relative to network analysis are performed by WimTube software (Wimasis GmbH, Germany). Histograms (g) are respectively referred to coverage area, tubules and knots; data reported are related to statistical analysis of images acquired in three independent experiments (* p <0.05).

Figure 9

Flt-1 and KDR receptors transcript levels in Ctrl and PrPKD cells. Graphs show Flt-1 and KDR receptors transcript levels in HUVEC Ctrl and PrPKD cells. RT-PCR results have been normalized on GADPH transcript levels (n=3).
Flt-1 and KDR receptors transcript levels in Ctrl and PrPKD cells. Graphs show Flt-1 and KDR receptors transcript levels in HUVEC Ctrl and PrPKD cells. RT-PCR results have been normalized on GADPH transcript levels (n=3).

Real-time PCR primer sequences and conditions

Target gene (host)GenBank no. accessionPrimers (sense, antisense)Tm (°C)bp
GADPH (R. norvegicus)NM_017008Fw 5’-CTGCTCCTCCCTGTTCTAGAGACA-3’ Rv 5’-CCGATACGGCCAAATCCGTTCACA-3’58105
PrPC (H. sapiens)NM_000311.3Rv 5’-CTCCCAGTCGTTGCCAAAAT -3’ Fw 5’-AACCTCAAGCATGTGGCAGG-3’56117
KDR (H. sapiens)NM_002253Rv 5’- GGCTCTTTCGCTTACTGTTC -3’ Fw 5’- TGCCTACCTCACCTGTTTC -3’62114
Flt-1 (H. sapiens)NM_002019Rv 5’-GGTGTGCTTATTTGGACATC-3’ Fw 5’-CGTAGAGATGTACAGTGAAA-3’58306
Language:
English
Publication timeframe:
4 times per year
Journal Subjects:
Life Sciences, Genetics, Biotechnology, Bioinformatics, Life Sciences, other
Journal RSS Feed