qPCR analysis of mesenchymal stem cell marker expression during the long-term culture of canine adipocyte derived stem cells
Published Online: Dec 31, 2020
Page range: 139 - 145
Received: Oct 12, 2020
Accepted: Nov 15, 2020
DOI: https://doi.org/10.2478/acb-2020-0017
Keywords
© 2020 Rut Bryl, Claudia Dompe, Maurycy Jankowski, Katarzyna Stefańska, Afsaneh Golkar Narenji, Jakub Kulus, Magdalena Kulus, Maria Wieczorkiewicz, Grzegorz Wąsiatycz, Jędrzej M. Jaśkowski, Mariusz Kaczmarek, James N. Petitte, Paul Mozdziak, Paweł Antosik, Dorota Bukowska, published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.
First described in 2001, ASCs are an effective source of mesenchymal progenitors [1]. In fact, they have mesenchymal stem cells-like characteristics and show great proliferation and differentiation potential and self-renewal ability, granting multiple and diverse clinical application and serving as a promising tool for gene-based therapies, including tissue engineering and regenerative medicine[2]. ASCs are multipotent and can differentiate into different cells types of the tri-germ lineages, as well as exhibit paracrine activity impacting immune responses [3]. They show ability to differentiate into many different cell types such as osteocytes, adipocytes, neural cells, vascular endothelial cells, cardiomyocytes, pancreatic cells, muscle cells and hepatocytes [4, 5, 6, 7, 8].
ASCs potential and qualities aside, this type of cells is readily accessible and is widely available. In fact, they are obtained through a minimally invasive procedure from adipose depots that are found at different locations throughout the body serving a variety of functions, including energy homeostasis of an organism. They can be isolated from tissues usually discarded upon surgery, for example excision of adipose tissue or liposuction, considered as the best method for storage preparation [9]. The analysis of samples obtained from liposuction do not show any significant loss of preadipocytes and no significant stroma damage. Since it is possible to obtain many ASCs from the adipose tissue, in vitro proliferation can be performed resulting in cells showing more predictable results [10].
Due to its availability and accessibility, adipose tissue has been the subject of various studies in many different medical fields and is believed to be a useful source of stem cells. The ability of ASCs to differentiate towards different cell lineages, with possibility of directing this differentiation, increases their possible clinical applications, and they have been widely employed in multiple therapies and treatment of different pathologies [11]. However, a deeper understanding of the molecular mechanisms underlying the ASCs osteoblastic and chondrocyte differentiation may lead to novel applications treating a multitude of different bone-related diseases through techniques more likely meeting worldwide consensus.
In this study, the RT-qPCR method was used to determine the changes in expression of ASC specific markers before and after long-term
Fat samples were obtained from adult dogs subjected to the routine sterilisation surgery at a commercial veterinary clinic. The process of material collection did not involve any additional medical procedures, as it was based on a usually discarded remnant tissue. Hence, the study did not necessitate obtaining of a bioethical committee approval.
After collection, the obtained tissue samples were placed in a DPBS solution supplemented with an antibiotic-antimycotic mix (Sigma-Aldrich, St. Louis, MO, USA). Afterwards, they were stored at 4°C until being transported to the laboratory for further processing no longer than 6h after collection. Upon arrival, the samples were subjected to a triple wash in ice-cold DPBS (to ensure the removal of remnant blood), minced with sterile surgical blades and placed in an 1mg/ml Collagenase I (solution in DMEM (Sigma-Aldrich, St. Louis, MO, USA) for the period of 40 minutes at 37°C. During that time, the sample was regularly vortexed to ensure maximum enzyme exposure. After the incubation period, the samples were centrifuged at 1200 x g for 20 mins. Furtherly, the resulting upper layer of mature adipocytes was discarded, while the pellet located at the bottom of the tube was resuspended in DMEM and centrifuged once more at 400 x g for 10 mins to ensure proper washing. Then, a fraction of the obtained cell solution was collected for identification analyses, while the remaining cells were seeded onto a 25cm3 culture flask in 4mL of DMEM.
The cells were cultured for a period of 14 days, with the culture media changed every 72h. The pictures of cells were taken every day to analyse the culture-induced changes in morphology. After the culture period, the culture media were removed. The cells were then double washed with DPBS, with 1mL of trypsin added to facilitate their detachment. After 5 min of incubation, the culture flasks were analysed under a 10x magnification to confirm full detachment, after which the cell suspension was transferred to a conical tube. FBS was added to neutralise the remaining enzymes, after which the sample was centrifuged again and suspended in 1mL of TRI Reagent for RNA isolation or PBS for flow cytometry analysis.
5 μL of antibodies were added to the bottom of flow cytometry tubes (following producer’s protocol), with around 100 μL of stained cell suspension. After 30 min of incubation, the mix was washed twice in 5 mL of PBS and centrifuged at 200 x g for 6 min, removing the remnant unbound antibodies. The antibodies used were Anti-Dog CD44, Anti-Dog CD90, and negative isotype controls, Anti-Dog, Anti-Dog CD45.
Each of the analyzed groups was processed in three independent samples. Total RNA was extracted from the samples using the TRI Reagent® (Sigma, St Louis, MO, USA), following the Chomczyński-Sacchi method [12]. After being collected from the cultures, the samples were suspended in 1ml of TRI Reagent (Sigma-Aldrich, Saint Louis, MO, USA), a mix of guanidine thiocyanate and phenol in monophasic solution. After the addition of chloroform, the samples were centrifuged to achieve separation of the 3 phases. The upper aqueous phase containing the RNA was collected with little or no contaminating DNA and proteins. The RNA was then stripped with 2-propanol (Sigma-Aldrich, Saint Louis, MO, USA) and washed with 75% ethanol. RNA, prepared in such way, was used for further analyses. Total mRNA was measured using the optical density at 260 nm, with the purity evaluated based on the 260/280 nm absorption ratio (above 1.8) (Nano-Drop spectrophotometer, Thermo Scientific, ALAB, Poland). RNA was diluted to a 100 ng/L concentration with an OD260 / OD280 ratio of 1.8 / 2.0.
To perform the RT-qPCR validation of the results, sequence specific primers for the genes of interest were designed using Primer 3 Software (Whitehead Institute, Cambridge, MA, USA. Gene sequences were obtained from Ensembl database, with the common parts of different transcript variants extracted by Clustal Omega Software (both EMBL, Heidelberg, Germany). All primers were designed as intron-in-tron border spanning to avoid genomic cDNA contamination (
The sequences of primers used in the analysis
GENE NAME | FORWARD PRIMER | REVERSE PRIMER |
---|---|---|
CTCAGGTCCCCAATGCTACC | GGTTGAAGGCCAGGTAGAGT | |
CCCATTGACGAACGGAACAA | TATACCACGTGAATTCCGCC | |
CACTAGAGCCCTGCGAAGTA | CGACGGCAATCATACACTGG | |
ATGAGACCTCCAGCTGTGAG | AGGTCAGACTGGTGCTTTCT | |
CGAGAATGCTACCACCTTGC | AGCCGGAGTTCACATGTGTA | |
ACCTAGGCAAACATGTGAGGA | CTTCCAGATCAAAATTTCCACGA | |
CCATCACATCGTAGCCCTC | ACTTTTATATCGCCCGTTGAC | |
CCCTTGCCGCTCCGCCTTC | GCAGCAATATCGGTCATCCAT |
Moderated t-statistics from the empirical Bayes method were preformed to determine the statistical significance of the genes analysed. The resulting p-value was corrected for multiple comparisons, using Benjamini and Hochberg’s false discovery rate. Genes were deemed to be significantly altered if they had a p-value below 0.05.
The research related to animal use has been complied with all the relevant national regulations and institutional policies for the care and use of animals. As the study was based on a remnant waste material, the Bioethical Committee approval was not necessary.
The morphology of the cultured ASCs was evaluated under a light microscope at the beginning (after the initial 3 day period of adhesion) and endpoint of the primary culture. The results were compiled and presented in the form of

Photographs of morphological changes between the beginning and end-point of
As can be seen, the initial fibroblast-like morphology changed to epithelial-like after the period of 14 day
The cultured cells were subjected to a flow cytometry assay using available canine antibodies targeting the known ASC markers. CD44 and CD90 expression was evaluated as positive, and lack of CD45 and CD34 as a negative marker. All of the antibodies were ran along their respective isotype control to correct for non-specific binding. The results were presented in the form of Mean Fluorescence Intensity graph (

The results of the flow cytometry analysis of the available canine ASC markers. The coloured peaks represent the cells stained by the specific antibodies, while the transparent peaks correspond to isotype controls.
As can be seen, CD44 and CD90 peaks present no significant overlap with their respective isotype controls, indicating the presence of these surface proteins on the analysed cells. In turn, CD45 and 34 show a major overlap with the isotype control, proving their expected lack of expression on the cells’ surface.
As the main aim of the study, the expression of MSC specific markers was evaluated in the cultured ASCs before and after the period of long-term

The results of the RT-qPCR analysis of the change in expression of ASC specific markers during a 14-day primary culture of adipocyte derived stem cells. All data was presented as a log10 of fold change.
As can be seen, the analysed ASC markers showed differing changes of expression during long-term
The recent literature places ASCs at the forefront of the potential candidates for stem cells based therapies for a variety of current diseases. This sparks a significant amount of
In this study, six MSC markers were analysed, as suggested by Dominici et al. [18]. The first one, CD105 is a well-known receptor for TGF-β [19]. It has been widely researched in the topic of cancer, especially tumour angiogenesis [20]. However, while it is also expressed in stem cells, its role is currently not fully elucidates, as it was demonstrated that its expression has no effect on differentiation ability and does not allow to distinguish a population of MSCs able to progress towards a chondrogenic lineage fate [21]. In this analysis, CD105 was the only positive marker that decreased in expression. The second surface protein, CD73, facilitates the conversion of mononucleotides to nucleosides, playing an important role in the maintenance of immune system homeostasis [22]. It has also been investigated in the context of cancer and was found to be a suppressor of antitumor immune response [23]. Hence, it has been a subject of studies targeting this surface protein in antitumor therapy [24]. In our study, this marker was notably upregulated in ASC primary
When it comes to negative markers, two of them were upregulated during the course of primary
Overall, the change in the expression of MSC markers during long-term primary culture suggests at least a partial loss of ASC characteristics, most probably caused by the influence of