About this article
Article Category: original-paper
Published Online: Dec 10, 2018
Page range: 407 - 416
Received: Nov 09, 2017
Accepted: Jun 28, 2018
DOI: https://doi.org/10.21307/pjm-2018-049
Keywords
© 2018 Eulalia Machowicz-Matejko et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.
Fig. 1.

Fig. 2.

Fig. 3.

Fig. 4.

Fig. 5.

Fig. 6.

Fig. 7.

Fig. 8.

The degree of identity and length of the covered sections of sequences as defined by the BLAST methods_
Species | Strain/isolate | The analyzed sequences from GenBank accession No. | ||||||||
---|---|---|---|---|---|---|---|---|---|---|
ITS | LSU | β-tubulin | ||||||||
No. GenBank | The degree of identity of sequence [%] = identity | Query cover nucleotides | No. GenBank | The degree of identity of sequence [%] = identity | Query cover nucleotides | No. GenBank | The degree of identity of sequence [%] = identity | Query cover nucleotides | ||
isolate B1-8 | KF986414.1 | 100 | 569 | |||||||
UFMGCB 6310 | KF373543.1 | 100 | 498 | |||||||
DY115-21-7-M6 | KF411572.1 | 100 | 551 | |||||||
Uncultured fungus | clone LX042233-122-012-B01 | GQ999240.1 | 99 | 574 | ||||||
isolate KH00279 | GU017500.1 | 99 | 574 | GU017541.1 | 99 | 835 | ||||
isolate KH00251 | GU017494.1 | 99 | 574 | GU017535.1 | 100 | 833 | ||||
Uncultured fungus | clone PR-MAT-CV5-17 | FJ265955.1 | 99 | 574 | ||||||
F55 | FJ755819.1 | 99 | 574 | |||||||
strain WR1996 | KP997215.1 | 99 | 544 | |||||||
Culture collection CCF<CZE> 3112 | FR727125.1 | 99 | 573 | |||||||
Uncultured fungus | clone PR-MAT-CV5-19 | FJ265957.1 | 99 | 571 | ||||||
isolate HNC15-78 | KT959298.1 | 99 | 530 | |||||||
Uncultured fungus | clone xnh90 | KP063524.1 | 99 | 574 | ||||||
43m | KC834810.1 | 99 | 527 | |||||||
Uncultured | clone CHiv38 | KP974191.1 | 99 | 574 | ||||||
Uncultured fungus | clone xnh20 | KP063454.1 | 99 | 574 | ||||||
Uncultured | clone Leof80 | KF225869.1 | 99 | 574 | ||||||
clone KJ34-0.2-39 | KT390118.1 | 99 | 791 | |||||||
U81265.1 APU81265 | 99 | 783 | ||||||||
CCF 3112 | FR775323.1 | 97 | 506 |
Primers used in PCR reaction_
Name | Primer | Primer sequence 5’-3’ | Melting temperature (Tm) °C | Primer orientation | Reference |
---|---|---|---|---|---|
ITS primers | ITS1 | TCCGTAGGTGAACCTGCGG | 59 | Forward | Ref. 28 |
ITS4 | TCCTCCGCTTATTGATATGC | 59 | Reverse | Ref. 28 | |
LSU primers | LROR | ACCCGCTGAACTTAAGC | 60 | Forward | Ref. 28 |
LR5 | TCCTGAGGGAAACTTCG | 60 | Reverse | Ref. 29 | |
β-tubulin primers | Bt2a | GGTAACCAAATCGGTGCTGCTTTC | 60 | Forward | Ref. 30 |
Bt2b | ACCCTCAGTGTAGTGACCCTTGGC | 60 | Reverse | Ref. 30 |