Open Access

Aspergillus penicillioides Speg. Implicated in Keratomycosis

,  and   
Dec 10, 2018

Cite
Download Cover

Fig. 1.

The disease symptoms of the cornea from which A. penicillioides was isolated.Photo E. Machowicz-Matejko.
The disease symptoms of the cornea from which A. penicillioides was isolated.Photo E. Machowicz-Matejko.

Fig. 2.

Colonies of A. penicillioides after 8 weeks of growing on culture media.a – PDA, b – YPD, c – Sabouraud, d – a poor medium (see M&M section). Photo E. Zalewska.
Colonies of A. penicillioides after 8 weeks of growing on culture media.a – PDA, b – YPD, c – Sabouraud, d – a poor medium (see M&M section). Photo E. Zalewska.

Fig. 3.

A. penicillioides cultured on PDA.Photo E. Zalewska.
A. penicillioides cultured on PDA.Photo E. Zalewska.

Fig. 4.

Conidiophores and conidia of A. penicillioides on PDA.Photo E. Zalewska.
Conidiophores and conidia of A. penicillioides on PDA.Photo E. Zalewska.

Fig. 5.

Conidiophores of A. penicillioides on PDA.Photo M. Wróbel.
Conidiophores of A. penicillioides on PDA.Photo M. Wróbel.

Fig. 6.

Conidia of A. penicillioides on PDA.Photo M. Wróbel.
Conidia of A. penicillioides on PDA.Photo M. Wróbel.

Fig. 7.

Electrophoretic separation of PCR products using universal primers for regions of the genes.a – rDNA (ITS1-5.8S-ITS4), b – LSU, c – β-tubulin. Photo A. Furmańczyk.
Electrophoretic separation of PCR products using universal primers for regions of the genes.a – rDNA (ITS1-5.8S-ITS4), b – LSU, c – β-tubulin. Photo A. Furmańczyk.

Fig. 8.

Phylogenetic tree of three native A. penicillioides isolates and the reference strains of Aspergillus spp. generated using the Maximum Likelihood method.
Phylogenetic tree of three native A. penicillioides isolates and the reference strains of Aspergillus spp. generated using the Maximum Likelihood method.

The degree of identity and length of the covered sections of sequences as defined by the BLAST methods_

SpeciesStrain/isolateThe analyzed sequences from GenBank accession No.
ITSLSUβ-tubulin
No. GenBankThe degree of identity of sequence [%] = identityQuery cover nucleotidesNo. GenBankThe degree of identity of sequence [%] = identityQuery cover nucleotidesNo. GenBankThe degree of identity of sequence [%] = identityQuery cover nucleotides
Aspergillus penicillioidesisolate B1-8KF986414.1100569
Aspergillus penicillioidesUFMGCB 6310KF373543.1100498
Aspergillus sp.DY115-21-7-M6KF411572.1100551
Uncultured fungusclone LX042233-122-012-B01GQ999240.199574
Aspergillus penicillioidesisolate KH00279GU017500.199574GU017541.199835
Aspergillus penicillioidesisolate KH00251GU017494.199574GU017535.1100833
Uncultured fungusclone PR-MAT-CV5-17FJ265955.199574
Aspergillus sp.F55FJ755819.199574
Aspergillus penicillioidesstrain WR1996KP997215.199544
Aspergillus penicillioidesCulture collection CCF<CZE> 3112FR727125.199573
Uncultured fungusclone PR-MAT-CV5-19FJ265957.199571
Aspergillus penicillioidesisolate HNC15-78KT959298.199530
Uncultured fungusclone xnh90KP063524.199574
Aspergillus sp.43mKC834810.199527
Uncultured Aspergillusclone CHiv38KP974191.199574
Uncultured fungusclone xnh20KP063454.199574
Uncultured Aspergillusclone Leof80KF225869.199574
Aspergillus penicillioidesclone KJ34-0.2-39KT390118.199791
Aspergillus penicillioidesU81265.1 APU8126599783
Aspergillus sp.CCF 3112FR775323.197506

Primers used in PCR reaction_

NamePrimerPrimer sequence 5’-3’Melting temperature (Tm) °CPrimer orientationReference
ITS primersITS1TCCGTAGGTGAACCTGCGG59ForwardRef. 28
ITS4TCCTCCGCTTATTGATATGC59ReverseRef. 28
LSU primersLRORACCCGCTGAACTTAAGC60ForwardRef. 28
LR5TCCTGAGGGAAACTTCG60ReverseRef. 29
β-tubulin primersBt2aGGTAACCAAATCGGTGCTGCTTTC60ForwardRef. 30
Bt2bACCCTCAGTGTAGTGACCCTTGGC60ReverseRef. 30
Language:
English
Publication timeframe:
4 times per year
Journal Subjects:
Life Sciences, Microbiology and Virology