Speg. Implicated in Keratomycosis

EULALIA MACHOWICZ-MATEJKO; AGNIESZKA FURMAŃCZYK; EWA DOROTA ZALEWSKA

Acceso abierto

Aspergillus penicillioides Speg. Implicated in Keratomycosis

EULALIA MACHOWICZ-MATEJKO

AGNIESZKA FURMAŃCZYK

EWA DOROTA ZALEWSKA

| 10 dic 2018

Polish Journal of Microbiology

Volumen 67 (2018): Edición 4 (December 2018)

Acerca de este artículo

Artículo anterior

Artículo siguiente

Cite

Article Category: original-paper

Publicado en línea: 10 dic 2018

Páginas: 407 - 416

Recibido: 09 nov 2017

Aceptado: 28 jun 2018

DOI: https://doi.org/10.21307/pjm-2018-049

Palabras clave
morphology, genetic characteristic, cornea

© 2018 Eulalia Machowicz-Matejko et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

The disease symptoms of the cornea from which A. penicillioides was isolated.Photo E. Machowicz-Matejko.

Colonies of A. penicillioides after 8 weeks of growing on culture media.a – PDA, b – YPD, c – Sabouraud, d – a poor medium (see M&M section). Photo E. Zalewska.

A. penicillioides cultured on PDA.Photo E. Zalewska.

Conidiophores and conidia of A. penicillioides on PDA.Photo E. Zalewska.

Conidiophores of A. penicillioides on PDA.Photo M. Wróbel.

Conidia of A. penicillioides on PDA.Photo M. Wróbel.

Electrophoretic separation of PCR products using universal primers for regions of the genes.a – rDNA (ITS1-5.8S-ITS4), b – LSU, c – β-tubulin. Photo A. Furmańczyk.

Phylogenetic tree of three native A. penicillioides isolates and the reference strains of Aspergillus spp. generated using the Maximum Likelihood method.

The degree of identity and length of the covered sections of sequences as defined by the BLAST methods.

Species	Strain/isolate	The analyzed sequences from GenBank accession No.
		ITS			LSU			β-tubulin
		No. GenBank	The degree of identity of sequence [%] = identity	Query cover nucleotides	No. GenBank	The degree of identity of sequence [%] = identity	Query cover nucleotides	No. GenBank	The degree of identity of sequence [%] = identity	Query cover nucleotides
Aspergillus penicillioides	isolate B1-8	KF986414.1	100	569
Aspergillus penicillioides	UFMGCB 6310	KF373543.1	100	498
Aspergillus sp.	DY115-21-7-M6	KF411572.1	100	551
Uncultured fungus	clone LX042233-122-012-B01	GQ999240.1	99	574
Aspergillus penicillioides	isolate KH00279	GU017500.1	99	574	GU017541.1	99	835
Aspergillus penicillioides	isolate KH00251	GU017494.1	99	574	GU017535.1	100	833
Uncultured fungus	clone PR-MAT-CV5-17	FJ265955.1	99	574
Aspergillus sp.	F55	FJ755819.1	99	574
Aspergillus penicillioides	strain WR1996	KP997215.1	99	544
Aspergillus penicillioides	Culture collection CCF<CZE> 3112	FR727125.1	99	573
Uncultured fungus	clone PR-MAT-CV5-19	FJ265957.1	99	571
Aspergillus penicillioides	isolate HNC15-78	KT959298.1	99	530
Uncultured fungus	clone xnh90	KP063524.1	99	574
Aspergillus sp.	43m	KC834810.1	99	527
Uncultured Aspergillus	clone CHiv38	KP974191.1	99	574
Uncultured fungus	clone xnh20	KP063454.1	99	574
Uncultured Aspergillus	clone Leof80	KF225869.1	99	574
Aspergillus penicillioides	clone KJ34-0.2-39				KT390118.1	99	791
Aspergillus penicillioides					U81265.1 APU81265	99	783
Aspergillus sp.	CCF 3112							FR775323.1	97	506

Primers used in PCR reaction.

Name	Primer	Primer sequence 5’-3’	Melting temperature (Tm) °C	Primer orientation	Reference
ITS primers	ITS1	TCCGTAGGTGAACCTGCGG	59	Forward	Ref. 28
ITS primers	ITS4	TCCTCCGCTTATTGATATGC	59	Reverse	Ref. 28
LSU primers	LROR	ACCCGCTGAACTTAAGC	60	Forward	Ref. 28
LSU primers	LR5	TCCTGAGGGAAACTTCG	60	Reverse	Ref. 29
β-tubulin primers	Bt₂a	GGTAACCAAATCGGTGCTGCTTTC	60	Forward	Ref. 30
β-tubulin primers	Bt₂b	ACCCTCAGTGTAGTGACCCTTGGC	60	Reverse	Ref. 30

eISSN:: 2544-4646
Idioma:: Inglés

Calendario de la edición:: 4 veces al año
Temas de la revista:: Life Sciences, Microbiology and Virology

RSS Feed de revista

Aspergillus penicillioides Speg. Implicated in Keratomycosis

Article Category: original-paper

Publicado en línea: 10 dic 2018

Páginas: 407 - 416

Recibido: 09 nov 2017

Aceptado: 28 jun 2018

DOI: https://doi.org/10.21307/pjm-2018-049

Palabras clave
morphology, genetic characteristic, cornea

© 2018 Eulalia Machowicz-Matejko et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1.

Fig. 2.

Fig. 3.

Fig. 4.

Fig. 5.

Fig. 6.

Fig. 7.

Fig. 8.

The degree of identity and length of the covered sections of sequences as defined by the BLAST methods.

Primers used in PCR reaction.

Aspergillus penicillioides Speg. Implicated in Keratomycosis

Article Category: original-paper

Publicado en línea: 10 dic 2018

Páginas: 407 - 416

Recibido: 09 nov 2017

Aceptado: 28 jun 2018

DOI: https://doi.org/10.21307/pjm-2018-049

Palabras clavemorphology, genetic characteristic, cornea

© 2018 Eulalia Machowicz-Matejko et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1.

Fig. 2.

Fig. 3.

Fig. 4.

Fig. 5.

Fig. 6.

Fig. 7.

Fig. 8.

The degree of identity and length of the covered sections of sequences as defined by the BLAST methods.

Primers used in PCR reaction.

Palabras clave
morphology, genetic characteristic, cornea