Endophytes are microorganisms, which colonize the living plant tissue asymptomatically, without causing any negative effect on the plant (Hirsch and Braun, 1992). Hallman et al. (1997) defined endophytes as any micro-organisms that live inside plant tissues without regard to the specific tissue colonized, and these can be isolated from surface sterilized plant tissues. The term endophytes were first introduced by de Bary in the year 1866. Later, the term was expanded to include actinomycetes, which spend part of or their whole life cycle inside the healthy living plant tissues, colonizing intra or inter-cellularly and causing no disease symptoms. Endophytic microorganisms are associated with living tissues, and may in some way contribute to the well-being of the plant (Haggag, 2010). They may facilitate their host plants to tolerate and withstand environmental stress (Malinowski and Belesky, 2000), as well as protect their hosts against pathogens and pests (Arnold et al., 2003; Akello et al., 2007) including nematodes. They have varied lifestyles and deal with the defense reactions of their hosts, overcome host resistance, enabling asymptomatic growth within the host. Endophytic bacteria colonizes an ecological niche, also used by plant pathogens, but are subjected to less competition with other microorganisms and less exposure to environmental stress factors, have sufficient supply with nutrients, and better translocation of bacterial metabolites throughout the host plant (Hallman et al., 1997). Endophytic bacteria seem to be distributed in most of the plant species and have been isolated from plant parts, namely, stems, leaves, roots, flowers, fruits and seeds (Lodewyckx et al., 2002). The population density of bacterial endophytes is higher in roots than in any other plant organ. In roots the average density is 1 × 105 cfu/g fresh weight whereas averages values of 1 × 104 and 1 × 103 cfu/g are reported for stem and leaf, respectively (Hallmann and Berg, 2006). Abundant and diverse populations of bacterial endophytes have been identified in various crops such as potato (Sturz et al., 1999; Garbeva et al., 2001), maize (Fisher et al., 1992; McInroy & Kloepper, 1995), cotton (McInroy & Kloepper, 1995) and cucumber (Mahafee & Kloepper, 1997).
Plant parasitic nematodes are the major constraints in crop production and cause an estimated $157 billion loss annually to different agricultural crops (Abad et al., 2008). Among plant parasitic nematodes, root-knot nematodes,
For isolation of endophytic bacteria, healthy leaf and stem samples were collected from randomly selected healthy plants of
The surface sterilized plant materials (stems and leaves) were dried properly in aseptic condition. The stem surface was peeled off with the help of a sterile scalpel in the laminar air flow cabinet. The stem and leave of each sample were cut into sections of 0.5 to 1 cm length and then these sections were placed on a nutrient agar medium supplemented with antifungal agents in Petri plates. The plates with plant tissues were sealed with parafilm tape and incubated at 28 ± 2°C in BOD to recover the maximum possible colonies of bacterial endophytes. After 24 to 48 hr of inoculation, morphologically different bacterial colonies were selected and were repeatedly streaked to achieve bacterial isolates (Anjum and Chandra, 2015).
A representative single colony of endophytic bacteria based on colony morphology was selected from the plates and transferred to slants and/or Petri plates to prepare and maintain a pure culture following standard protocols. Endophytic bacterial cultures were maintained throughout the investigation in Nutrient agar (NA) medium by routine sub-culturing at regular intervals and storage at 4°C in the refrigerator. The stored bacterial isolates were used for further studies, as well as for confirmation of results.
Gram staining was done as per the standardized protocol of Rangaswami and Bagayaraj (1993). The bacterial suspension was prepared in sterile distilled water. From this suspension a smear was prepared on a clean and dry glass slide, air dried and then heat fixed by keeping the lower side of the slide on a light flame. The smear was then flooded with 1% crystal violet solution for 1 to 2 min and then the slide was washed in clean water. After removal of excess water, Gram’s iodine stain was applied and after 30 to 60 sec, the slide was washed with clean water for few seconds and air dried. Smears on the slide were then decolorized with 95% ethyl alcohol (decolourizing agent). Decolourizing was done by holding the slide at about 45o angle and adding alcohol drop by drop over the smear to flow over the smear. When the smear became colorless, the slide was washed immediately with clean water for 2 to 3 sec. Then safranin was applied to counter stain. After 45 to 60 sec, the stained slide was washed with clean water, air dried and observed under oil immersion to see the colors of the bacteria. Gram positive bacteria appear purple to blue black whereas gram negative bacteria appear red or pink. The most efficient isolates were structurally analysed using a scanning electron microscope, following the procedure of Watson et al. (1980). Biochemical tests (namely, KOH, Citrate, Gelatin hydrolysis, Catalase, Starch hydrolysis) and motility tests of all the isolates were carried out following standard procedures (Bora et al., 2015).
A single eggmass of
hundred milliliters of nutrient broth media for each isolate was prepared in 250 ml Erlenmeyer flasks and seeded with isolated bacterial endophytes separately. The inoculated flasks were incubated at 28 ± 2°C on a shaker for 48 hr. The liquid culture was filtered through a Whatman No. 1 filter paper and passed through a bacterial filter (Aalten and Gowen, 1998), after which the filtrates were centrifuged at 6000 rpm for 15 min. The supernatant was collected in a 100 ml erlenmeyer flasks for further study and the suspended residues were discarded.
To check the efficacy of the isolated bacterial culture filtrate to kill of second stage juvenile of the root-knot nematode,
The most efficient isolates in the in vitro assay were selected for amplification of the 16S rDNA. Genomic DNA was extracted using the EXpure Microbial DNA extraction kit from Bogar Bio Bee stores Pvt. Ltd. Amplification of the genomic DNA were carried out using 16S rRNA based primer i.e. forward primer—27F (5′ AGAGTTTGATCTGGCTCAG 3′) and reverse primer- 1492R (5′ TACGGTACCTTGTTACGACTT 3′). For each PCR, a 25µl reaction mixture was prepared (containing Target DNA template —5 µl; Taq Master Mix—12 µl; Forward Primer —1.5 µl; Reverse Primer— 1.5 µl and Deionized water—5 µl). The PCR was performed in a thermal cycler (Applied Biosystem Pvt. Ltd.) for 22 cycles. The PCR thermal cycle consisted of an initial denaturation of 2 min at 95°C, followed 30 sec at 95°C for denaturation, 30 sec at 50°C for primer annealing and in last step primer extension for 2 min at 72°C. Steps 2, 3, and 4 were repeated for 22 cycles followed by a final extension of 10 min at 72°C.
The PCR products were sequenced at Triyat scientific Co. Pvt. Ltd., Maharashtra. The isolates were identified by comparative matching of the 16S rRNA gene sequence with homologus sequence using NCBI blast similarity search tool (
The statistical analyses were performed by using statistical package (WASP) 2.0 of CCARI (Central Coastal Agricultural Research Institute), Goa. The percent mortality of
A total of 15 endophytic bacteria were isolated during the present investigation; 8 from the leaf of
Endophytic bacterial isolates from
Source | Tissue | No. of isolates | Name of isolates |
---|---|---|---|
|
leaf | 8 | BETL1, BETL2, BETL3, BETL4, BETL5, BETL6, BETL7 and BETL8 |
|
stem | 2 | BETS1 and BETS2 |
|
leaf | 5 | BEKL1, BEKL2, BEKL3, BEKL4 and BEKL5 |
Note: BETL1 to BETL8 = Bacteria Endophyte Tomato Leaf 1 to 8. BETS1 & BETS2 = Bacteria Endophyte Tomato Stem 1 & 2. BEKL1 to BEKL5 = Bacteria Endophyte
Growth of endophytic bacteria from cut pieces of stem and leaf on NA media.
All the isolated bacteria exhibited diverse colony, different shape and color, namely, orange, yellowish orange, shiny yellow, dark yellow, yellow, white, cream etc. Regarding cell shape and gram staining, out of the 15 isolates 6 were gram-positive rods, 4 were gram-negative rods, 2 were gram-negative diplococcus and 3 were gram-negative coccus. Among the 15 isolates, the morphological features of the four most efficient isolates based on in vitro tests were studied using Field Emission Scanning Electron Microscope (FESEM) method and are shown in Figures S1a, S1b, S2a, S2b, S3a, S3b, S4a & S4b. The biochemical tests revealed that,- 9 isolates were positive for KOH, 11 isolates were positive for citrate and all the 15 isolates showed positive results for catalase and gelatine hydrolysis test. However, only 6 isolates showed positive results for the starch hydrolysis test. The result indicated that they can produce the enzyme citritase, gelatinase, catalase and starch hydrolytic enzyme. The cultural characteristics of the isolates are presented in Table 2.
Scanning Electron Micrograph of isolate EBTL1 (
Scanning Electron Micrograph of isolate BETL2 (
Scanning Electron Micrograph of isolate BETL4 (
Scanning Electron Micrograph of isolate BETS2 (
Morphological and biochemical characteristics of the isolated strains of endophytic bacteria.
Isolated strains | Colour | Grams’ staining | Shape | Motility | KOH | Citrate utilization | Gelatin hydrolysis | Catalase test | Starch hydrolysis |
---|---|---|---|---|---|---|---|---|---|
BETL1 | Orange | +ve | Rod | + | -ve | +ve | +ve | +ve | -ve |
BETL2 | Shiny yellow | +ve | Rod | + | -ve | -ve | +ve | +ve | -ve |
BETL3 | Dark yellow | -ve | Rod | + | +ve | +ve | +ve | +ve | +ve |
BETS1 | Yellow | -ve | Rod | + | +ve | -ve | +ve | +ve | -ve |
BETL4 | White | +ve | Rod | + | -ve | +ve | +ve | +ve | +ve |
BETL5 | Yellow | -ve | Diplococcus | + | +ve | -ve | +ve | +ve | -ve |
BETL6 | Shiny yellow | +ve | Rod | + | -ve | +ve | +ve | +ve | -ve |
BEKL1 | White | -ve | Coccus | + | +ve | +ve | +ve | +ve | -ve |
BETS2 | Yellowish orange | +ve | Rod | + | -ve | -ve | +ve | +ve | +ve |
BEKL2 | Cream | -ve | Rod | + | +ve | +ve | +ve | +ve | +ve |
BETL7 | White | -ve | Coccus | + | +ve | +ve | +ve | +ve | +ve |
BEKL3 | Yellow | -ve | Diplococcus | + | +ve | +ve | +ve | +ve | -ve |
BEKL4 | Cream | -ve | Coccus | + | +ve | +ve | +ve | +ve | -ve |
BETL8 | Cream | +ve | Rod | + | -ve | +ve | +ve | +ve | +ve |
BEKL5 | Yellow | -ve | Rod | + | +ve | +ve | +ve | +ve | -ve |
Based on the result of in vitro mortality test against the
Phylogenetic tree showing the genetic relationship of the BETL1 isolate to other isolates by using maximum likelihood method.
Phylogenetic tree showing the genetic relationship of the BETL2 isolate to other isolates by using maximum likelihood method.
Phylogenetic tree showing the genetic relationship of the BETL4 isolate to other isolates by using maximum likelihood method.
Phylogenetic tree showing the genetic relationship of the BETS2 isolate to other isolates by using maximum likelihood method.
Phylogenetic tree showing the genetic relationship of the BETL6 isolate to other isolates by using maximum likelihood method.
The culture filtrates of all isolated bacterial strains exhibited varying degrees of nematicidal effect on second stage juvenile (J2) of
Effect of culture filtrate of isolated bacterial endophytes on juvenile mortality of
Period of exposure (hrs) | |||||||
---|---|---|---|---|---|---|---|
Treatment | Culture filtrate concentration | 6 | 12 | 24 | 48 | Treatment (T) Mean | Culture filtrate concentration (C) Mean |
BETL1 | S/10 | 58.00 (49.61) | 64.00 (53.18) | 75.33 (60.23) | 80.67 (63.96) | 79.07 (63.64)c | 47.24 (42.36) |
S/6 | 66.67 (54.86) | 71.33 (57.67) | 78.00 (62.04) | 84.00 (66.48) | 55.78 (47.70) | ||
S/4 | 72.00 (58.09) | 78.67 (62.51) | 80.00 (63.49) | 88.67 (70.53) | 63.09 (52.62) | ||
S/2 | 73.33 (61.60) | 82.00 (64.96) | 84.67 (66.97) | 92.00 (73.94) | 69.79 (57.62) | ||
S | 81.33 (64.49) | 86.67 (68.70) | 88.67 (70.53) | 95.33 (78.90) | 76.51 (63.12) | ||
BETL2 | S/10 | 54.67 (47.68) | 66.00 (54.34) | 76.67 (61.16) | 84.67 (67.08) | 81.47 (66.74)a | |
S/6 | 60.00 (50.79) | 72.00 (58.09) | 80.67 (64.05) | 90.00 (71.76) | |||
S/4 | 64.00 (53.14) | 78.00 (62.04) | 85.33 (67.61) | 94.00 (76.11) | |||
S/2 | 78.00 (62.23) | 85.33 (67.61) | 91.33 (72.95) | 100.00 (89.93) | |||
S | 83.33 (65.99) | 89.33 (71.06) | 95.33 (78.90) | 100.00 (89.93) | |||
BETL3 | S/10 | 8.00 (16.35) | 22.00 (27.90) | 44.00 (41.52) | 60.67 (51.19) | 49.07 (44.17)m | |
S/6 | 10.67 (18.93) | 28.00 (31.78) | 47.33 (43.47) | 64.00 (53.14) | |||
S/4 | 19.33 (26.04) | 38.00 (37.99) | 60.67 (51.18) | 70.67 (57.25) | |||
S/2 | 26.00 (30.63) | 52.67 (46.53) | 67.33 (55.15) | 78.00 (62.09) | |||
S | 50.00 (45.00) | 67.33 (55.28) | 80.67 (63.93) | 86.00 (68.11) | |||
BETS1 | S/10 | 26.67 (31.04) | 48.67 (44.23) | 63.33 (52.75) | 76.67 (61.23) | 65.90 (55.13)jk | |
S/6 | 31.33 (33.98) | 52.00 (46.15) | 72.00 (58.13) | 80.00 (63.49) | |||
S/4 | 35.33 (36.45) | 62.67 (52.36) | 78.00 (62.09) | 82.67 (65.45) | |||
S/2 | 40.00 (39.22) | 69.33 (56.41) | 80.00 (63.49) | 88.67 (70.63) | |||
S | 67.33 (55.15) | 80.67 (63.96) | 89.33 (71.06) | 93.33 (75.23) | |||
BETL4 | S/10 | 52.00 (46.15) | 64.00 (53.14) | 72.67 (58.50) | 82.00 (64.96) | 81.43 (66.62)ab | |
S/6 | 61.33 (51.59) | 72.67 (58.50) | 80.00 (63.46) | 86.00 (68.11) | |||
S/4 | 70.00 (56.85) | 79.33 (63.00) | 87.33 (69.24) | 91.33 (72.95) | |||
S/2 | 76.67 (61.27) | 85.33 (67.51) | 93.33 (75.23) | 97.33 (82.77) | |||
S | 86.67 (68.70) | 91.33 (72.95) | 100.00 (89.93) | 100.00 (89.93) | |||
BETL5 | S/10 | 31.33 (34.01) | 46.00 (42.69) | 50.67 (45.38) | 67.33 (55.21) | 64.20 (53.72)l | |
S/6 | 40.00 (39.20) | 57.33 (49.22) | 66.00 (54.42) | 70.67 (57.39) | |||
S/4 | 46.67 (43.06) | 66.00 (54.34) | 72.67 (58.50) | 77.33 (61.60) | |||
S/2 | 48.67 (44.23) | 72.67 (58.50) | 78.00 (62.09) | 82.00 (64.99) | |||
S | 62.00 (51.96) | 78.00 (62.14) | 82.67 (65.45) | 88.00 (69.93) | |||
BETL6 | S/10 | 52.00 (46.15) | 60.67.00 (51.21) | 72.67 (58.55) | 80.67 (63.96) | 78.17 (63.56)de | |
S/6 | 60.67 (51.17) | 70.00 (56.80) | 78.00 (62.09) | 84.00 (66.48) | |||
S/4 | 66 (54.39) | 76.67 (61.16) | 82.67 (65.45) | 89.33 (71.06) | |||
S/2 | 72.00 (58.14) | 80.00 (63.46) | 88.00 (69.93) | 94.67 (78.21) | |||
S | 78.67 (62.56) | 86.00 (68.11) | 90.67 (72.36) | 100.00 (89.93) | |||
BEKL1 | S/10 | 19.33 (25.92) | 26.00 (30.54) | 65.33 (53.97) | 76.67 (61.18) | 67.20 (56.23)h | |
S/6 | 36.00 (36.84) | 42.67 (40.78) | 74.67 (59.83) | 80.67 (63.99) | |||
S/4 | 44.00 (41.52) | 48.67 (44.23) | 80.00 (63.53) | 84.67 (67.08) | |||
S/2 | 65.33 (53.97) | 76.00 (60.69) | 82.67 (65.58) | 89.33 (71.06) | |||
S | 81.33 (64.45) | 87.33 (69.24) | 88.67 (70.53) | 94.67 (79.60) | |||
BETS2 | S/10 | 42.00 (40.39) | 66.00 (54.36) | 70.67 (57.27) | 83.33 (65.94) | 78.87 (65.15)cd | |
S/6 | 51.33 (45.76) | 71.33 (57.68) | 80.67 (64.05) | 87.33 (69.50) | |||
S/4 | 60.00 (50.78) | 80.67 (63.96) | 86.00 (68.11) | 90.00 (71.76) | |||
S/2 | 70.67 (57.27) | 84.00 (66.48) | 90.67 (72.36) | 96.67 (81.88) | |||
S | 82.67 (65.45) | 88.67 (70.53) | 94.67 (78.21) | 100.00 (89.93) | |||
BEKL2 | S/10 | 22.67 (28.30) | 29.33 (32.77) | 44.00 (41.55) | 68.67 (55.99) | 73.33 (60.72)f | |
S/6 | 60.00 (50.80) | 69.33 (56.45) | 79.33 (62.99) | 85.33 (67.57) | |||
S/4 | 68.67 (55.99) | 76.00 (60.74) | 84.00 (66.48) | 89.33 (71.42) | |||
S/2 | 72.00 (58.09) | 80.67 (63.96) | 88.67 (70.47) | 94.67 (78.21) | |||
S | 77.33 (61.65) | 84.00 (66.48) | 92.67 (74.53) | 100.00 (89.93) | |||
BETL7 | S/10 | 18.00 (25.01) | 30.67 (33.61) | 51.33 (45.77) | 70.67 (57.28) | 66.23 (55.37)j | |
S/6 | 27.33 (31.47) | 41.33 (39.99) | 61.33 (51.57) | 80.67 (64.05) | |||
S/4 | 54.00 (47.31) | 70.00 (56.85) | 76.67 (61.14) | 85.33 (67.51) | |||
S/2 | 68.00 (55.56) | 75.33 (60.25) | 83.33 (65.94) | 91.33 (72.95) | |||
S | 76.00 (60.69) | 81.33 (64.49) | 87.33 (69.24) | 94.66 (76.81) | |||
BEKL3 | S/10 | 14.00 (21.89) | 33.33 (35.24) | 57.33 (49.23) | 73.33 (58.99) | 67.19 (56.08)hi | |
S/6 | 36.00 (36.86) | 46.67 (43.08) | 71.33 (57.67) | 79.33 (63.15) | |||
S/4 | 52.00 (46.15) | 61.33 (51.61) | 82.00 (64.99) | 86.67 (68.70) | |||
S/2 | 66.00 (54.34) | 73.33 (58.94) | 86.00 (68.37) | 90.67 (72.36) | |||
S | 70.67 (57.23) | 80.00 (63.46) | 89.33 (71.06) | 94.67 (78.21) | |||
BEKL4 | S/10 | 15.33 (22.92) | 42.67 (40.78) | 64.67 (53.55) | 82.00 (64.99) | 71.33 (59.95)g | |
S/6 | 20.67 (26.94) | 54.67 (47.68) | 78.00 (62.09) | 87.33 (69.24) | |||
S/4 | 34.00 (35.61) | 66.67 (54.79) | 88.00 (69.93) | 92.67 (74.53) | |||
S/2 | 66.00 (54.36) | 80.00 (63.46) | 91.33 (73.24) | 96.67 (80.67) | |||
S | 82.67 (65.49) | 88.67 (70.53) | 94.67 (78.21) | 100.00 (89.93) | |||
BETL8 | S/10 | 16.00 (23.51) | 22.00 (27.90) | 28.00 (31.91) | 36.00 (36.86) | 37.07 (37.25)o | |
S/6 | 21.33 (27.46) | 26.00 (30.63) | 32.67 (34.84) | 42.67 (40.78) | |||
S/4 | 27.33 (31.49) | 31.33 (34.03) | 38.00 (38.04) | 49.33 (44.62) | |||
S/2 | 32.67 (34.84) | 36.67 (37.26) | 46.67 (43.08) | 54.00 (47.31) | |||
S | 40.00 (39.22) | 46.00 (42.70) | 52.67 (46.53) | 62.00 (52.01) | |||
BEKL5 | S/10 | 20.67 (27.03) | 25.33 (30.19) | 30.67 (33.61) | 35.33 (36.46) | 39.20 (38.61)n | |
S/6 | 26.67 (31.07) | 30.67 (33.61) | 36.00 (36.84) | 40.00 (39.22) | |||
S/4 | 30.00 (33.19) | 35.33 (36.46) | 42.67 (40.77) | 46.67 (43.08) | |||
S/2 | 35.33 (36.46) | 42.00 (40.39) | 48.67 (44.23) | 52.67 (46.53) | |||
S | 41.33 (40.01) | 49.33 (44.62) | 55.33 (48.07) | 59.33 (50.39) | |||
Distilled Water (SDW) | S | 0 | 0 | 0 | 0 | (0.00) | |
S | 0 | 0 | 0 | 0 | |||
S | 0 | 0 | 0 | 0 | |||
S | 0 | 0 | 0 | 0 | |||
S | 0 | 0 | 0 | 0 | |||
Period of Exposure(t) Mean | 46.93 (42.16) | 58.28 (49.34) | 68.51 (56.29) | 76.23 (62.95) |
Note: CV = 5.50, CD(P = 0.05): Treatment (T): 0.80; Concentration (C): 0.45; Period of exposure (t): 0.40; T × C: 1.79; T×t: 1.61; C×t: 0.89; T × C×t: 3.59. Figures in the parentheses are Arc-Sine transformed values. Mean followed by the same letter in the superscript(s) are not significantly different.
Effect of culture filtrates of isolated bacterial endophytes on juvenile mortality of
During the present study, fifteen endophytic bacteria were isolated from leaves and stems of
The preliminary identification of the isolated endophytic bacteria was done based on morphological, cultural and biochemical features. Among the 15 isolates, there were gram-positive rods, and gram-negative rods, diplococcus and coccus. In the biochemical tests, 9 isolates were positive to KOH, 11 isolates were positive to citrate and all the 15 isolates showed positive results for catalase and gelatine hydrolysis test however, only 6 isolates showed the positive results for starch hydrolysis test. Similar results have been found in previous studies. Patel et al. (2012) isolated eighteen (HR1 to HR18) endophytic bacteria from the stem and roots of tomato plant from different region of Gujarat, India and found that, 10 bacteria (55.55%) were gram-negative coccobacilli, 5 bacteria (27.77%) gram-positive bacilli and 3 bacteria (16.66%) were gram-negative cocci. Prasom et al. (2017) isolated 43 endophytic bacteria from healthy tomato plants and found that 79.07% bacteria were gram-positive whereas, 20.93% were gram-negative bacteria with different colony characteristics; of these, 79.% bacteria showed KOH positive test, 20.93% showed KOH negative test; 27.91% bacteria were coccus shaped, 60.46% were bacillus and only 11.63% were coccobacilli in shape.
The five most effective endophytic bacteria against second stage juveniles of
In the present study cell free culture filtrates of all fifteen bacterial isolates exhibited nematicidal property in vitro against J2 of
Efficacy of