Isolation and characterization of endophytic bacteria from tomato foliage and their in vitro efficacy against root-knot nematodes

For isolation of endophytic bacteria, healthy leaf and stem samples were collected from randomly selected healthy plants of Solanum lycopersicum and S. pimpinellifolium (konbilahi), from different places of Jorhat district of Assam, namely, Alengmora, Rowriah, Malowali, Gorumora, Dergaon, and were brought to the laboratory under sterilized conditions. The collected plant samples were washed under slow running tap water to remove adhering soil particles followed by surface sterilization with sodium hypochlorite solution (2%) containing 0.1% Tween 20 for 3 min. The samples were then successively rinsed three times with sterile distilled water and, dried with sterile paper towels. All these activities were carried out under a laminar air flow cabinet (Hallman et al., 1997; Zinniel et al., 2003). For sterility check, the sterilized leaf and stem samples were placed on Nutrient agar (NA) plates as well as culturing aliquots of water from the last rinsing onto nutrient broth (NB) and kept in a BOD (Biological oxygen demand) at 28 ± 2°C for 48 hr. Samples were discarded if microbial growth was detected in the sterility check (Hallman et al., 1997; Gyaneshwar et al., 2001).

The surface sterilized plant materials (stems and leaves) were dried properly in aseptic condition. The stem surface was peeled off with the help of a sterile scalpel in the laminar air flow cabinet. The stem and leave of each sample were cut into sections of 0.5 to 1 cm length and then these sections were placed on a nutrient agar medium supplemented with antifungal agents in Petri plates. The plates with plant tissues were sealed with parafilm tape and incubated at 28 ± 2°C in BOD to recover the maximum possible colonies of bacterial endophytes. After 24 to 48 hr of inoculation, morphologically different bacterial colonies were selected and were repeatedly streaked to achieve bacterial isolates (Anjum and Chandra, 2015).

A representative single colony of endophytic bacteria based on colony morphology was selected from the plates and transferred to slants and/or Petri plates to prepare and maintain a pure culture following standard protocols. Endophytic bacterial cultures were maintained throughout the investigation in Nutrient agar (NA) medium by routine sub-culturing at regular intervals and storage at 4°C in the refrigerator. The stored bacterial isolates were used for further studies, as well as for confirmation of results.

A single eggmass of M. incognita was collected from the pure culture maintained in brinjal at the Department of Nematology, AAU, Jorhat. After 24 hr, the hatched second stage juveniles were inoculated in pots with tomato seedlings growing in sterilized soil. These inoculated tomato plants were maintained and used as a source for inoculum for the subsequent work.

hundred milliliters of nutrient broth media for each isolate was prepared in 250 ml Erlenmeyer flasks and seeded with isolated bacterial endophytes separately. The inoculated flasks were incubated at 28 ± 2°C on a shaker for 48 hr. The liquid culture was filtered through a Whatman No. 1 filter paper and passed through a bacterial filter (Aalten and Gowen, 1998), after which the filtrates were centrifuged at 6000 rpm for 15 min. The supernatant was collected in a 100 ml erlenmeyer flasks for further study and the suspended residues were discarded.

To check the efficacy of the isolated bacterial culture filtrate to kill of second stage juvenile of the root-knot nematode, M. incognita race2, in vitro tests were carried out. Extracted cell free culture filtrate of the isolated endophytic bacteria was considered as the stock solution—S (100% concentration). The stock solution was diluted with sterile distilled water to have S/2(50%), S/4(25%), S/6(17%) and S/10(10%) concentration of cell-free bacterial culture filtrates. Two (2) ml of cell free culture filtrate of each isolated endophytic bacteria was poured in to a sterile cavity block. To each cavity block, 30 surface sterilized M. incognita juveniles (J₂) were added. All cavity blocks were kept in the laboratory at room temperature (25^oC + 2) and arranged in a completely randomized block design (CRD) with five replications. Observation of juvenile mortality was recorded at 6, 12, 24 and 48 hr of exposure time. Apart from the treatments with different concentration of culture filtrates, sterile distilled water (SDW) was also kept as control. For determining the number of dead nematodes, a revival test was conducted by transferring the immobile juveniles to sterile distilled water and observing their activities after 24 hr under a stereo zoom binocular microscope. The juveniles showing no movement even when they were probed with bamboo splinter were considered dead. The percent juvenile mortality was calculated as follows: Percent mortality = Number of dead juveniles in the treatment Total number of juveniles in the treatment × 100

The most efficient isolates in the in vitro assay were selected for amplification of the 16S rDNA. Genomic DNA was extracted using the EXpure Microbial DNA extraction kit from Bogar Bio Bee stores Pvt. Ltd. Amplification of the genomic DNA were carried out using 16S rRNA based primer i.e. forward primer—27F (5′ AGAGTTTGATCTGGCTCAG 3′) and reverse primer- 1492R (5′ TACGGTACCTTGTTACGACTT 3′). For each PCR, a 25µl reaction mixture was prepared (containing Target DNA template —5 µl; Taq Master Mix—12 µl; Forward Primer —1.5 µl; Reverse Primer— 1.5 µl and Deionized water—5 µl). The PCR was performed in a thermal cycler (Applied Biosystem Pvt. Ltd.) for 22 cycles. The PCR thermal cycle consisted of an initial denaturation of 2 min at 95°C, followed 30 sec at 95°C for denaturation, 30 sec at 50°C for primer annealing and in last step primer extension for 2 min at 72°C. Steps 2, 3, and 4 were repeated for 22 cycles followed by a final extension of 10 min at 72°C.

The statistical analyses were performed by using statistical package (WASP) 2.0 of CCARI (Central Coastal Agricultural Research Institute), Goa. The percent mortality of M. incognita J₂ were subjected to arc-sine transformation before analysis. The interaction effect between time, concentration and treatment were conducted by using three factorial completely randomized designs. The critical differences in main effects i.e., isolates, concentration and time of exposure as well as in their interactions were tested at P = 0.05. Duncan’s multiple range test (DMRT) were conducted to determine the significance difference among the treatments.

A total of 15 endophytic bacteria were isolated during the present investigation; 8 from the leaf of Solanum lycopersicum, 2 from the stem of Solanum lycopersicum and 5 from the leaf of Solanum pimpinellifolium (konbilahi) (Table 1) and Figure 1.

Figure 1:

All the isolated bacteria exhibited diverse colony, different shape and color, namely, orange, yellowish orange, shiny yellow, dark yellow, yellow, white, cream etc. Regarding cell shape and gram staining, out of the 15 isolates 6 were gram-positive rods, 4 were gram-negative rods, 2 were gram-negative diplococcus and 3 were gram-negative coccus. Among the 15 isolates, the morphological features of the four most efficient isolates based on in vitro tests were studied using Field Emission Scanning Electron Microscope (FESEM) method and are shown in Figures S1a, S1b, S2a, S2b, S3a, S3b, S4a & S4b. The biochemical tests revealed that,- 9 isolates were positive for KOH, 11 isolates were positive for citrate and all the 15 isolates showed positive results for catalase and gelatine hydrolysis test. However, only 6 isolates showed positive results for the starch hydrolysis test. The result indicated that they can produce the enzyme citritase, gelatinase, catalase and starch hydrolytic enzyme. The cultural characteristics of the isolates are presented in Table 2.

Figure S1:

Figure S2:

Figure S3:

Figure S4:

Based on the result of in vitro mortality test against the M. incognita juveniles, the 5 most efficient isolates were identified by sequencing of 16S rRNA. The identified endophytic isolates were Microbacterium arborescens (BETL1), Bacillus marisflavi (BETL2), Bacillus altitudinis (BETL4), Exiguobacterium indicum (BETS2), Bacillus marisflavi (BETL6) and are shown in Figures 2–6.

Figure 2:

Figure 3:

Figure 4:

Figure 5:

Figure 6:

The culture filtrates of all isolated bacterial strains exhibited varying degrees of nematicidal effect on second stage juvenile (J₂) of M. incognita under laboratory conditions and were significantly different from control (Table 3). The percent mortality of J₂ of M. incognita was found to be directly proportional to the concentration of the culture filtrate and the period of exposure time (Table 3 and Fig. 7). All the fifteen isolated bacterial endophytes showed significant increase in mortality of J₂ of M. incognita irrespective of concentrations of the culture filtrates (C) and duration of exposure time (t) as compared to the control (SDW), where no mortality of J₂ of M. incognita was recorded. Among the 15 strains of isolated endophytes, the culture filtrate of BETL2 (Bacillus marisflavi) was found to cause maximum mortality of J₂ of M. incognita at all the tested concentrations compared to other endophytes, with 100% mortality of J₂ of M. incognita in S and S/2 concentration and 84.67% mortality in S/10 concentration after 48 hr of exposure time, followed by BETL4 (Bacillus altitudinis) and BETL1 (Microbacterium arborescens). Irrespective of concentration of culture filtrate and period of exposure time, the mortality rate of J₂ of M. incognita caused by isolate BETL2 reached 81.47%, which was at par with isolate BETL4 (81.43%), followed by isolate BETL1 (79.07%), which is at par with isolate BETS2 (78.87%) followed by BETL6 (78.17%). There was no significant difference between BETS2 and BETL6. All the fifteen isolates, except BETL8 and BEKL5 caused more than 44% J₂ mortality during 24 hr exposure time at S/10 concentration of culture filtrate (Fig. 7). Irrespective of isolate and exposure time, the mortality rate of M. incognita J₂, at the lowest concentration (S/10) was 47.24% whereas, at the highest concentration (S), mortality rate was 76.51%. Similarly, irrespective of isolate and concentration of culture filtrate, the mortality rate of M. incognita J₂ was highest 76.23% at 48 hr exposure time and lowest 46.93% at 6 hr exposure time (Table 3).

Figure 7: