Otwarty dostęp

Sexually transmitted diseases in symptomatic and asymptomatic Thai women and girls: a study from Bangkok and nearby


Zacytuj

While human papillomavirus (HPV) is the most common sexually-transmitted infection (STI) worldwide. Chlamydia trachomatis and Neisseria gonorrhea are major bacterial causes of STIs [1, 2]. Rugpao et al. [3] cultivated bacteria from cervices of women with clinical symptoms. Among these, 7.8% were C. trachomatis and 4.8% N. gonorrhea. Celentano et al. [4] reported C. trachomatis to be even more prevalent (22%) than N. gonorrhea (6%) by culture- and DNA-based techniques. They reported that ages 20-25 years and subjects reporting more than 2 heterosexual partners were associated with a higher risk of the STIs [4]. The prevalence was probably underestimated. These infections were also found in apparently healthy men and women. For example, C. trachomatis infections in humans are initially often asymptomatic until they become severe, causing pelvic inflammatory disease, ectopic pregnancy, and infertility [2, 5-8]. We therefore focused this study on the presence or absence of C. trachomatis, N. gonorrhoeae, and HPV infections in women and girls with symptomatic inflamed urogenital tracts and also on asymptomatic apparently healthy controls.

C. trachomatis is known for long-term, persistent infections that could be aided by low-levels of human interferon-γ immune responses, degrading tryptophan, which is an essential amino acid required for bacterial growth [8, 9]. This amino acid-starved condition leads to persistent C. trachomatis infection and enhances bacteria to remain viable in a nonculturable (dormant) state. Such persistent C. trachomatis infection can be resistant to the bacteriostatic action of commonly prescribed C. trachomatis antibiotics. In brief, persistent C. trachomatis expresses minimal gene transcription and translation, which is a target for doxycycline and tetracycline [8, 10, 11]. Importantly, persistent C. trachomatis infection can last for several years in the female urogenital tract [6-8].

An outer membrane protein A gene (ompA) encodes the major outer membrane and ompA sequencing represents an established method to categorize C. trachomatis into 19 serovars. These are A to C, including Ba, which cause trachoma, D to K including Da, which cause noninvasive urogenital infections and trachoma in newborns, and L to L3, which cause an invasive urogenital infection called lymphogranuloma venereum [2, 12]. Globally, C. trachomatis serovars D, E, and F are the most common sexually transmitted diseases (STDs) [2].

C. trachomatis tryptophan synthesis, α-subunit (trpA) sequence, was included in this study because of the association between C. trachomatis persistence and possible trpA mutation. Tryptophan is essential for chlamydiae to replicate. Limited tryptophan, through the effect of human interferon-γ, can induce chlamydial persistence [8, 10]. Interferon-γ stimulates a tryptophan-degrading enzyme named indoleamine-2,3-dioxygenase. Polymorphisms in trpA in various C. trachomatis serovars can affect the structure and function of TrpA and, for instance, result in truncated TrpA in serovars A–C. This mutation also disrupts chlamydial tryptophan synthesis from indole substrates. TrpA in most urogenital serovars is functional [8, 13, 14].

This study included the molecular detection of HPV and Neisseria gonorrhoeae, because these pathogens share transmission routes and are often found associated. Importantly, long-term C. trachomatis infection may increase the risk for acquisition and retention of the high-risk HPV variants that cause cervical cancer. Likewise, long-term HPV infection may increase the risk of persistence, and for more severe clinical outcomes from C. trachomatis infection [8, 15]. This study aimed to describe STD prevalence in women and girls seeking treatment in the Bangkok region and to determine the efficiency of doxycycline treatment for C. trachomatis along with the genetic characteristics of C. trachomatis ompA and trpA.

Materials and methods
Participants

Participants included 284 Thai women and girls aged 15-54 years attending the Buddhachinaraj Phitsanulok Hospital, Bangrak STD clinic, which is part of the Office of Disease Prevention and Control 1 Bangkok, and Office of Disease Prevention and Control 3 of Chonburi province. All participants were HIV-negative, and had neither cervical cancer nor previous cervical cancer treatment. Participants were grouped as (i) upper genital tract (UGT), (ii) lower genital tract (LGT), and (iii) undefined UGT or LGT infection; based on U.S. Centers for Disease Control and Prevention definitions [2]. Samples were obtained by clinicians, following a standard cervical swab sample collection method and a medium using M4RT (Illinois, USA). For the symptomatic group, 100 mg of doxycycline, twice daily for 14 days, was prescribed, and refrain from sexual contact during treatment until follow-up sample collection 14 days after treatment was completed [2, 7, 11, 12]. All samples were collected during September 2011–2012 for Buddhachinaraj Phitsanulok Hospital, and March 2013–2014 for the other sites.

The study was approved by the Institutional Review Board of Buddhachinaraj Phitsanulok Hospital (101/54), and the Ethics Committee for Research in Human Subjects of the Department of Disease Control, Bangkok (FWA00013622). Written informed consent was obtained from all subjects for their participation in the study. Clinical samples were identified by a unique identification number with no link to patient names.

Molecular detections for C. trachomatis, N. gonorrhoeae, HPV, and human β-globin

DNA was extracted from a 100 μL aliquot of each clinical sample was according to High Pure Template Preparation Kit instructions (Roche Diagnostics Corporation, Indianapolis, IN, USA). Concentration and quality of the extracted DNA were measured by A260 nm and A260/A280 nm spectrophotometry. The extracted DNA had an average A260/A280 between 1.80 and 2. C. trachomatis, N. gonorrhoeae, HPV, and human β-globin were detected by PCRs following established protocols [12, 16-18]. Primers and PCR annealing temperatures were listed in Table 1: Ct.ompA.60UF and Ct.ompA.VB3 were primers for C. trachomatis ompA first-half; Ct.ompA.MVF3 and Ct.ompA.220DR for ompA second-half; Ng.opa.F and Ng.opa.R to Ng.opa.R2 for primary N. gonorrhoeae; Ng.porA.F and Ng.porA.R for confirmed positive N. gonorrhoeae; PGMY11-A to PGMY11-D, and PGMY09-F to HMB01 as forward and reverse primer cocktails for HPV L1 gene; and globinF and globinR for human β-globin. Sizes and semi-quantitation of the PCR products were determined from agarose gel electrophoresis. All negative PCR results were repeated to confirm the negative results.

PCR primers and annealing temperatures

Primer namePrimer sequence (5′ → 3′)Tm (°C)
Ct.ompA.60UFGTCCCGCCAGAAAAAGATAG45
Ct.ompA.VB3CATCGTAGTCAATAGAGGCAT
Ct.ompA.MVF3TGTAAAACGACGGCCAGTGCCCGTGCAGCTTTGTGGGAATGT45
Ct.ompA.220DRGCGCTCAAGTAGACCGATATAGTA
F.Ct.trpAATTAGCCACCGATGAAGAG50
R.Ct.trpAATGTTGAATTAGGAGAGTTGTTAT
Ng.opa.FTTGAAACACCGCCCGGAA60
Ng.opa.RTTTCGGCTCCTTATTCGGTTTAA
Ng.opa.R1TTTCGGCTCCTTATTCGGTTTGA
Ng.opa.R2TTTCGGCTCCTTATTCGGTTTGA
Ng.porA.FCAGCATTCAATTTGTTCCGAGTC60
Ng.porA.RGAACTGGTTTCATCTGATTACTTTCCA
PGMY11-AGCACAGGGACATAACAATGG50
PGMY11-BGCGCAGGGCCACAATAATGG
PGMY11-CGCACAGGGACATAATAATGG
PGMY11-DGCCCAGGGCCACAACAATGG
PGMY11-EGCTCAGGGTTTAAACAATGG
PGMY09-FCGTCCCAAAGGAAACTGATC
PGMY09-GCGACCTAAAGGAAACTGATC
PGMY09-HCGTCCAAAAGGAAACTGATC
PGMY09-IGCCAAGGGGAAACTGATC
PGMY09-JCGTCCCAAAGGATACTGATC
PGMY09-KCGTCCAAGGGGATACTGATC
PGMY09-LCGACCTAAAGGGAATTGATC
PGMY09-MCGACCTAGTGGAAATTGATC
PGMY09-NCGACCAAGGGGATATTGATC
PGMY09-PGCCCAACGGAAACTGATC
PGMY09-QCGACCCAAGGGAAACTGGTC
PGMY09-RCGTCCTAAAGGAAACTGGTC
HMB01GCGACCCAATGCAAATTGGT
globinFGAAGAGCCAAGGACAGGTAC58
globinRCAACTTCATCCACGTTCACC
C. trachomatis ompA and trpA sequencing and bioinformatics analyses

trpA PCR were performed using F.Ct.trpA and R.Ct.trpA primers (Table 1). The ompA and trpA PCR products were DNA purified, and sequenced at Macrogen Inc (Seoul, Korea). All sequences were validated using an electropherogram (BioEdit version 7.0.0, Carlsbad, CA, USA). The sequences were deposited in GenBank under accession numbers KM369928 to KM369961. The ompA sequences were identified as C. trachomatis serovars by BLASTN against the GenBank nucleotide nonredundant database [19]. Multiple sequences were aligned using MEGA 5 software (Institute of Molecular Evolutionary Genetics, Pennsylvania State University, University Park, PA, USA), and compared with 19 reference C. trachomatis serovars A-L3: A/Har-13 (NC007429), B/TW-5 (DQ064281 ompA), Ba/ Apache-2 (DQ064282 ompA, AY096806 trpA), C/ TW-3 (NC023060), D/UW-3 (NC000117), Da/TW-448 (X62921 ompA, KM369947 trpA), E/Bour (NC020971), F/IC-Cal3 (DQ064287 ompA, AY096810 trpA), G/UW-57 for ompA (AF304326), G/UW-524 trpA (AY096811), H/UW-4 (AE304328 ompA, AY096812 trpA), I/UW-12 (DQ064290 ompA, AY096813 trpA), Ia/IU-4168 (AF063201 ompA, KM369958 trpA), J/UW-36 (DQ064292 ompA, AY096814 trpA), Ja/IU-37538 ompA (AF202458), Ja/UW-92 trpA (KM369959), K/UW-31 (DQ064293 ompA, AY096815 trpA), L1/440 (DQ064294 ompA, AY096816 trpA), L2/434 (DQ064295 ompA, AY096817 trpA), L2a/TW-396 (AF304858 ompA, KM369961 trpA), and L3/404 (DQ064296 ompA, AY096818 trpA). A variant was defined as having ≥ 1 nucleotide (nt) difference from the sequence of the reference strain. The p-distance and neighbor-joining tree with 1,000 bootstrap replicates were constructed using MEGA 5.

Comparative structure modeling of C. trachomatis TrpA and active TrpA-TrpB complex

C. trachomatis TrpA three-dimensional structure was constructed using consensus TrpA sequences from reference serovars D to K, by MODWEB (http://salilab.org/modweb) [20]. MODWEB uses PSI-BLAST [19] and IMPALA [21] to obtain representative three-dimensional structures from the Protein Data Bank (PDB) (http://www.rcsb.org), and then uses MODELLER to align our query sequence with the representative PDB structure [22]. Every modeled structure was given a GA341 model score. The GA341 of >0.7 means reliable structure prediction, with >95% probability of the correct fold [20-22], and all of our modeled structures had GA341 of 1.0. The structures were visualized using the UCSF Chimera tool (http://www.cgl.ucsf.edu/chimera) [23]. Critical sites, including active sites, binding sites and TrpB communication (COMM) domain, were annotated based on the structural alignment to the representative PDB structures (1qopA for TrpA and 1qopB for TrpB, from Salmonella typhimurium) [24], and literature reviews [25, 26]. The structural alignments were accomplished using the MultAlign Viewer program [23].

Results
Prevalence of C. trachomatis, N. gonorrhoeae, and HPV

Of 284 total participants, HPV (86 individuals: 30.3%) was detected most frequently, followed by C. trachomatis (37 individuals: 13.0%) and N. gonorrhoeae (30 individuals: 10.6%), respectively. After categorizing based on symptomatic versus healthy or asymptomatic groups, the ranking remained valid for symptomatic urogenital group (HPV 48%, C. trachomatis 22%, and N. gonorrhoeae 6%), but asymptomatic group (N. gonorrhoeae 16%, HPV 10%, and C. trachomatis 3%) (Table 2). For the symptomatic group, coinfections with C. trachomatis and HPV were found commonly, compared with C. trachomatis and N. gonorrhoeae coinfections (Tables 2 and 3). Samples with no C. trachomatis, N. gonorrhoeae, or HPV were positive for the human -globin gene (data not shown). This was to confirm the quality of the DNA, because all samples must be at least positive for this human housekeeping gene.

Characterization of symptoms based on the progression of the diseases (UGT or LGT) showed that the pathogens were more frequently detected in the UGT and LGT than in the undefined, and the asymptomatic groups; except for N. gonorrhoeae (Table 2). HPV and C. trachomatis were found even more frequently when symptoms reached the UGT than LGT (23% HPV, and 12% C. trachomatis). Although samples were collected at the cervix and the number of participants with UGT was smaller than the number of participants with LGT. Additionally, categorization of symptomatic women and girls by age showed that those in the 15–34 age range had more than 70% of infections with C. trachomatis (76%), N. gonorrhoeae (78%), and HPV (72%) (Table 2).

For symptomatic women and girls, those not engaged in commercial sex (non-CSWs) had a lower prevalence of C. trachomatis (82% CSW compared to 18% in non-CSW), N. gonorrhoeae (67% CSW, 33% non-CSW), and HPV (68% CSW, 32% non-CSW) infections. In those women and girls who appeared healthy, C. trachomatis was found relatively more commonly in CSWs (Table 2).

Prevalence of STIs in symptomatic and asymptomatic urogenital tract females

Symptom location

Symptom location includes UGT (upper urogenital tract), LGT (lower urogenital tract), Undefined (undefined UGT or LGT), and none for asymptomatic

(n)
Ct

Ct represents C. trachomatis

(%)
Ng

Ct represents C. trachomatis

(%)
HPV (%)Characterized by ages (%)Ct

Ng represents N. gonorrhoeae

(%)
Ng

Ng represents N. gonorrhoeae

(%)
HPV (%)Characterized by occupation (%)Ct (%)Ng (%)HPV (%)
Symptomatic
UGT1843515-2412 (36)2 (22)18 (25)Commercial129
(57)(12)(3)(23)25-345 (15)1 (11)8 (11)sex worker(3)(22)(13)
35-441 (3)1 (11)6 (8)
Non-commercial17226
45-54001 (1)sex worker(52)(22)(36)
N/A002 (2)
LGT1452915-244 (12)011 (15)Commercial4110
(75)(9)(3)(19)25-344 (12)4 (44)11 (15)sex worker(12)(11)(14)
35-445 (15)07 (10)Non-commercial10419
45-541 (3)1 (11)0sex worker(30)(44)(26)
N/A000
Undefined10815-24001 (1)Commercial104
(18)(1)(5)25-34003 (4)sex worker(3)(6)
35-44000Non-
45-54000commercial(6)
N/A1 (3)04 (6)sex worker
Total3397215-2416 (48)2 (22)30 (42)Commercial6323
(150)(22)(6)(48)25-349 (27)5 (56)22 (31)sex worker(18)(33)(32)
35-446 (18)1 (22)13 (18)Non-commercial27649
45-541 (3)1 (11)1 (1)sex worker(82)(67)(68)
N/A1 (3)06 (8)
Asymptomatic
None4211415-2407 (33)6 (43)Commercial3107
(134)(3)(16)(10)25-344 (100)6 (29)1 (7)sex worker(75)(47.62)(50)
35-4404 (19)4 (29)Non-commercial1117
45-5403 (14)3 (21)sex worker(25)(52.38)(50)
N/A01 (5)0

N/A means age information is not available

C. trachomatis ompA serovar distributions and persistence

Nineteen random symptomatic patients with C. trachomatis infections were ompA sequenced to identify serovars: 6 belonging to D, 4 E, 4 F, 2 G, 2 H, and 1 K. These patients underwent a complete course of doxycycline treatment. While the majority of patients did not come back for C. trachomatis follow-up examination after treatment, all patients who came back had persistence of C. trachomatis of the same serovar found before treatment (Table 3).

C. trachomatis serovar distribution and infection pattern after doxycycline treatment

SymptomaticNo. of patients (%)Doxycycline treatment
C. trachomatisN. gonorrhoeaeHPV
BeforeAfterBeforeAfterBeforeAfter
Serovar D6 (32)62/4

The number after the solidus (/) represents the number of patients who did not come back after the treatment for C. trachomatis, N. gonorrhoeae, or HPV

0031/2
Serovar E4 (21)41/30041/3
Serovar F4 (21)41/310/141/3
Serovar G2 (11)20/20010/1
Serovar H2 (11)20/20010/1
Serovar K1 (5)10/10000
Polymorphisms of ompA among 14 clinical isolates from Thai women and girls

Full-length ompA sequences of 14 clinical isolates from Thai women and girls, compared with respective reference serovars, demonstrated that all clinical Ds had 2-4 ompA nt polymorphisms compared to reference D, and D/U14bf and D/L11bf had 0.003– 0.006 ± 0.002–0.003 p-distance from D (Table 4). Note that D/U1bf and D/U9bf harbored the same ompA polymorphisms that caused 0.000 p-distance against D (Table 4). ompA variants were also observed in 1 clinical F and 2 Hs. Most polymorphisms were of different nt positions, and many encoded for amino acid changes and thus high dN/dS. Bidirectional sequencing indicated H/U20bf and H/ L23bf containing a substitution that caused a stop codon (W295). However, these ompA variants remained phylogenetically clustered with their respective reference strains (Figure 1).

Polymorphisms of C. trachomatis ompA and trpA among 14 Thai clinical isolates compared with the respective reference serovars

ompAtrpA
Reference ompA genotypePatient namep-distance±S.E.nt differences (type and position of changes)dN/dS

dN/dS represents the ratio of non-synonymous (dN) to synonymous (dS) amino acid changes

(type and position of changes)
Serovars that the clinical sequence is most similar to

If >1 serovars are most similar to the ompA or trpA sequence of the clinical isolate, the serovars are listed in alphabetical order (A, Ba, C, D, Da, E, F, G, H, I, Ia, J, Ja, K, L1, L2, L2a, L3) and bold for the respective reference serovar. For trpA analysis, serovar Β is excluded because of its lack of trpA

p-distance±S.E.nt differences (type and position of changes)dN/dS (type and position of dN changes)Serovars that the clinical sequence is most similar to
D/Ulbf.000±.0003 (G903A, A927QA937G) Y313C)3/0(D301N, S309GD.000 ±.0000D, K
D/U9bf.000±.0003 (G903A, A927QA937G)3/0(D301N, S309G, Y313C)D.000 ±.0000D, K
DD/U14bf.006±.0034(C258G, C594T, T601C, G603C)0/4D.000 ±.0000D, K
D/Lllbf.003 ± .0022(C258C, G428C)1/1 (S143T)D.005 ±.0033(A110G, C344T, G530A)3/0(Q37R, A115V, C177Y)H, Ia, J, Ja
E/U2bf.000 ±.0000E.000 ±.0000E
E/U4bf.000 ±.0000E.000 ±.0000E
EE/U28bf.000 ±.0000E.000 ±.0000E
E/L8bf.000 ±.0000E.000 ±.0000E
FF/U29bf.000 ±.0000F.000 ±.0000F, I
F/Llbf.000 ±.0002(G769C, G775C)2/0(R257T, S259T)F.000 ±.0000F, I
GG/U18bf.000 ±.0000G.002 ±.0021 (C10T)0/1F, I
G/U3M.000 ±.0000G.002 ±.0021 (C10T)0/1F, I
H/U20bf.000 ±.0002(G795A, G885A)2/0(G265R, W295.)H.004 ±.0022(G110A, T344C)2/0(R37Q, V115A)F, I
HH/L23bf.000 ±.0004(C270A, A271C, C850T, G885A)4/0(N90H, T284I, W295.)H.000 ±.0000H, Ia, J, Ja
KK/U15bf.000 ±.0000K.000 ±.0000D,K

Figure 1

Neighbor-joining tree representing evolutionary relatedness of full-length ompA sequences from 19 C. trachomatis reference strains and 14 clinical isolates of serovars D, E, F, G, H, and K from Thai women and girls. All clinicals represent the isolates before antibiotic treatment. The length of branch is proportional to the distance between sequences, and number at node is the percent bootstrap confidence for clustering of strains.

Polymorphisms of trpA among 14 Thai clinical isolates

Clinical D, Gs, and H demonstrated trpA polymorphisms; many of which encoded for nonsynonymous amino acid changes, causing high dN/ dS. Moreover, the trpA polymorphisms were at the positions that affected the phylogenetic relatedness among serovars. These clinical trpA variants became grouped with the different reference serovars: D/L11bf instead clustering with H, Ia, J, and Ja; and G/U18bf, G/U31bf, and H/U20bf clustered with F and I (Table 4 and Figure 2).

Figure 2

Neighbor-joining tree representing evolutionary relatedness of full-length trpA sequences from 19 C. trachomatis reference strains and 14 clinical isolates from Thai women and girls (serovars D, E, F, G, H and K). All clinical isolates represent the first collected isolates prior to antibiotic treatment. Length of branch is proportional to distance between sequences, and number at node is the percent bootstrap confidence for clustering of strains.

Analysis of C. trachomatis trpA polymorphisms on TrpA and TrpA–TrpB modeling structures

To investigate the possible effects of clinical trpA variants, three-dimensional structures of TrpA and active TrpA-TrpB complex were computed. The computed structures yielded the GA341 model scores of 1.0, which represented perfect modeling scores. This indicated that greater than 95% of the modeling structures were correct [20]. Figure 3A demonstrates the clinical trpA polymorphisms at around TrpA critical sites. For instance, C177Y was one of the active TrpA residues, and Q37R/R37Q was located close to another active TrpA residue. Further, for tryptophan synthesis to proceed, TrpA and TrpB subunits must form an active, planar TrpA–TrpB–TrpB–TrpA complex (Fig. 3B). During the process, the COMM domain of TrpB joined and lifted up TrpA to broaden the tunnel lining TrpA and TrpB active residues, allow indole substrate to be converted to tryptophan. In Figure 3B, C177Y is also positioned close to the interacting COMM domain. By contrast, when tryptophan is available, TrpA and TrpB do not interact and the COMM domain of TrpB shifts downward [24-26].

Figure 3

Three-dimensional structures of non-active TrpA (A) and active TrpA–TrpB complex (B), with the nonsynonymous amino acid polymorphisms in respected to the clinical D/L11bf and H/U20bf (Q37R/R37Q, A115V/V115A, and C177Y). Clinical polymorphisms were represented in gray with atomic bonds, critical TrpA and TrpB residues (including C177Y) in gray, and TrpB COMM domain in white.

Discussion

Our findings that HPV is the most common STI, and that C. trachomatis is more common than N. gonorrhoeae (Table 2) are consistent with previous reports worldwide; including those from Thailand [1-3]. There was a greater prevalence of HPV and C. trachomatis in symptomatic subjects with UGT and LGT than in asymptomatic women and girls. Table 2 highlights that these pathogens cause a clinical burden more often than N. gonorrhoeae. In addition, coinfection between C. trachomatis and HPV was common (Tables 2 and 3). This is consistent with previous studies that reported C. trachomatis infection likely promoted acquisition and retention of high-risk HPV types that also cause cervical cancer [8, 15].

Younger symptomatic patients (15-34 years), and non-CSWs were more often found with the STIs (Table 2: symptomatic group). Younger age might represent higher risks because of unprotected sex, multiple sex partners, and shared needle use [4]. C. trachomatis and HPV infections were also more common in the UGT than the LGT (Table 2), supporting the fact that C. trachomatis could reach and induce excess inflammation at the UGT including ovary and spermatic tubes. This can result in sterility [2, 5, 8, 10]. The greater finding of C. trachomatis in women and girls with UGT symptoms is associated with multiple disease complications [5, 8].

Asymptomatic women and girls, who reported no clinical symptom and had normal urogenital tracts on examination, were nevertheless infected by STIs (38 patients or 28%). Such infected individuals can transmit the diseases unwittingly, and might have clinical symptoms later in their lives.

Table 3 supports the inconsistent success of common C. trachomatis approved antibiotics and the persistent state of C. trachomatis infection and/or resistance where drugs had been used [10]. These included tetracycline, azithromycin, and doxycycline, which target bacterial protein synthesis. A state of persistent C. trachomatis infection with no or only minimal protein synthesis, offers no target for the action of these antibiotics [7, 8, 10-12]. Previous studies examined whether Chlamydiae that were antibiotic-resistant in vivo were because of antibiotic-resistant strains or not. They found that all Chlamydiae, once cultivated in vitro in a normal life cycle, remained sensitive to these antibiotics [7]. In vitro, interferon-γ induces persistence of C. trachomatis, which is able to resume a normal life cycle upon tryptophan supplementation. Unfortunately, only few of our patients returned for follow-up after antibiotic treatment. This suggests that there may have been undetected treatment failures and therefore further risk for transmission [2, 8, 15].

Our study of C. trachomatis ompA serovar distribution adds knowledge of the serovar dynamic in Thailand and is consistent with previous reports [3, 4]. Serovars D, E, and F remain the most common, followed by G and H, and K in this order (Table 3). This might also highlight the successful phenotypic characteristics of these serovars. Some ompA mutations were identified in Ds, F, and Hs. G885A in 2 and Hs caused an early stop codon at W295 compared with the reference H. A similar scenario was previously reported for clinical Da/TW-448 (GenBank no. X62921), but at a different nt position. Therefore, the 2 clinical Hs from Thai patients with symptomatic cases and the clinical Da might harbor some similar evolutionary pathway. A similar mutation pattern was diagnosed; yet this still requires validation. Nonetheless, Thai ompA variants in this study remained clustered with their respective references (Table 4 and Figure 1). Therefore, these ompA polymorphisms might cause no effect on the OmpA phenotype between the Thai and the reference strains.

To date, there are limited studies on trpA variants in clinical samples from Asia. Meanwhile, trpA was reported to contain several hotspots that could affect phylogenetic clustering and the tryptophan synthesis ability of Chlamydiae [13, 14]. This study included trpA sequencing and TrpA three-dimensional structure analysis to understand better the clinical trpA representing recent clinical strains in Thailand. Multiple sequence alignment and phylogenetic trees could not cluster some Thai clinical trpA with the respective references (Table 4 and Figure 2). It is further signified that some Thai clinical trpA mutations might be of importance, possibly correlate with altered TrpA phenotypes, and might help understand chlamydial pathogenesis.

To help evaluate clinical effects of trpA polymorphisms, three-dimensional structures of TrpA and active TrpA-TrpB complex were modeled with confident score (GA341 = 1.0), and the nonsynonymous amino acid mutations were analyzed. While diminished tryptophan could lead to chlamydial eradication, a restricted tryptophan level could induce C. trachomatis persistence, as TrpA allows Chlamydia to resume a normal life cycle by synthesizing tryptophan when indole substrate is available [14]. TrpA and TrpB form an active complex where the COMM domain of TrpB shifts up to broaden the TrpA–TrpB tunnel, and allows indole to catalyze to tryptophan [25-28]. Interestingly, the C177Y mutation in D/L11bf was at an active TrpA site (Figure 3A), so the mutation might affect TrpA activity. C177Y, which is also located close to the TrpA–TrpB interaction (Figure 3B), further affecting the connection between TrpA and TrpB [24, 25]. The change from cysteine (polar with thiol side chain (R–SH)) to tyrosine (aromatic R group) was critical, because the thiol side chain is often involved in enzymatic reaction [24, 25, 29]. Moreover, cysteine often forms a disulfide bond (S–S) with another cysteine to tighten and stabilize the structural fold, so its mutation from cysteine to tyrosine might affect the structure of the protein. This could be a way to favor chlamydial persistence and strain persistence in spite of antibiotic treatment (Table 3). For instance, the disrupted fold by C177Y might impair the tryptophan synthesis ability, causing the chlamydiae to remain persistent even when indole substrate is available. The other mutations, Q37R or R37Q and A115V or V115A (Table 4), served hotspots that distinguish between reference serovars [13]. For Q37R/R37Q, the substitution between glutamine and arginine could affect the charge type of protein, because glutamine is a negatively charged amino acid with acidic side chain, while arginine is a positively charged amino acid with basic side chain [29]. For A115V/V115A, valine is a big-size amino acid that is often found associated with β-sheet formation [29]. This substitution could affect TrpA conformation, because residue 115 was part of the helix (Figure 3).

Conclusions

Our study revealed the frequency of STIs in symptomatic and apparently healthy asymptomatic Thai women and girls, and evidence for C. trachomatis persistent infection in patients attending STD clinics in Bangkok and nearby. The high rate of HPV and C. trachomatis among symptomatic individuals suggests increased virulence of these infections compared with N. gonorrhoeae, and the common coinfection between C. trachomatis and HPV. Persistent C. trachomatis infection is serious, as it promotes severe clinical outcomes (i.e. pelvic inflammatory disease, ectopic pregnancy, and sterility) and predisposes to high-risk HPV types and antibiotic treatment failures. These findings are consistent with previous reports. Persistence of C. trachomatis, despite treatment with doxycycline, is of growing concern. While clinical ompA sequences were still relatively close to reference sequences, clinical trpA sequences contained mutations that might affect the TrpA structure and function. Knowledge of these trpA variants may help to understand chlamydial evolution and pathogenesis in the Thai population.

eISSN:
1875-855X
Język:
Angielski
Częstotliwość wydawania:
6 razy w roku
Dziedziny czasopisma:
Medicine, Assistive Professions, Nursing, Basic Medical Science, other, Clinical Medicine