Tuberculosis is a disease caused by several pathogenic bacteria from the genus
Tuberculosis is a major global health problem, with almost 9 million new infections and more than 1 million fatalities reported globally yearly (WHO 2019). Despite implementing prevention and control measures, tuberculosis is still considered a primary concern for Saudi Arabia’s public health system, with over sixty thousand tuberculosis cases reported annually (Al Ammari et al. 2018).
Conventional microbiological methods, such as direct microscopic observation and culture characteristics, either suffer from reduced specificity or are time-consuming due to the slow growth rate of the
Rifampicin (RIF) and isoniazid (INH) are the most appropriate first-line antibiotics to treat MTBC infections (Hakkimane et al. 2018). Isolates of the MTBC resistant to RIF and INH are considered multidrug-resistant tuberculosis (MDR-TB) (Pienaar et al. 2018). Resistance to RIF occurs because of mutations in the region between amino acid codons 507–533 within the
The resistance to multiple drugs poses significant challenges for controlling the MTBC. Thus, it is crucial to identify MDR-MTBC strains to prevent their spread properly (Kibret et al. 2017).Methodology optimization, elevated cost, and time consumption are all considered to be major problems facing conventional antibiotic sensitivity testing for MDR-MTBC (Dusthackeer et al. 2020). Several nucleic acid amplification tests are available for laboratory diagnosis of bacterial resistance and have proven to be quick, highly sensitive, and specific in detecting drug-resistant tuberculosis isolates. One such is the GeneXpert MTB/RIF test for detecting RIF resistance (Cohen et al. 2019; Zong et al. 2019).Nevertheless, the GeneXpert MTB/RIF test cannot differentiate DR-TB from MDR-TB and is limited to detecting RIF-resistant TB alone. Another method is multiplex allele-specific PCR (MAS-PCR), which uses different sets of specific outer primers flanking the mutation regions that facilitate accurate and simultaneous recognition of the most common INH and RIF resistance-related gene mutations (Yang et al. 2005).
Molecular- and non-molecular-based techniques, including conventional PCR amplification of the IS
After ethical approval was obtained from the Ministry of Health, Kingdom of Saudi Arabia (Approval Number H-03-M-084), the investigators obtained 48 sputum samples from the Central Tuberculosis Laboratory in the Al-Madinah region. The Central Tuberculosis Laboratory is considered the health authority responsible for receiving samples from patients clinically diagnosed with tuberculosis in any health care unit of Al-Madinah region including its seven governorates. The 48 sputum samples were obtained over 13 months from June 2018 to June 2019.
Digestion and decontamination of sputum specimens were carried out using an equal volume of N-acetyl-L-cysteine-sodium hydroxide (NALC-NaOH) solution (4% sodium hydroxide, 1% N-acetyl-L-cysteine in 2.9% sodium citrate), followed by centrifugation and suspension of the resulting pellet in phosphate buffer (pH 6.8). The suspended pellet was split into five equal parts. The first part was cultured in a modified Middle-brook 7H9 broth medium of the BACTEC MGIT 960 system (Becton Dickinson, USA). Another part of the specimens was examined by performing an acid-fast Ziehl-Neelsen stain.
The GeneXpert MTB/RIF assay was applied to confirm the presence of MTBC DNA and RIF resistance in the specimens using the third part of the processed sputum samples according to the manufacturer’s protocol. The system automatically couples nucleic acid extraction and the real-time PCR amplification technique of DNA probes to detect the targeted MTBC sequences and part of the
DNA extraction from the fourth part of the processed sputum specimens was performed by the CTAB-phenol-chloroform method (Mani et al. 2003). A final concentration of less than 40 μg/ml and a purity ratio of (1.8–2.1) of DNA were used for the PCR assay. Two explicit primer pairs for MTBC were used to amplify the 123 bp fragment of the insertion sequence IS
PCR primers for amplifying
Gene | Primer sequence (5’-3’) | PCR product size | Purpose |
---|---|---|---|
IS |
F: CCTGCGAGCGTAGGCGTCGG | 123 bp | |
R: CTCGTCCAGCGCCGCTTCGG | |||
F: CTGGTCGAATTCGGTGGAGT | 152 bp | ||
R: ATGGTCTCCGACACGTTCGAC | |||
(OF) F: ATACGACCTCGATGCCGC | 335 bp | Isoniazid resistance detection (Yang et al. 2005; Sinha et al. 2019) | |
(5R) R: GCAGATGGGGCTGATCTACG | |||
(P15) F: GCGCGGTCAGTTCCACA | 270 bp | ||
(PF2) R: CACCCCGACAACCTATCG | |||
(516) F: CAGCTGAGCCAATTCATGGA | 218 bp |
Rifampin resistance detection (Yang et al. 2005; Sinha et al. 2019) | |
(526) F: CTGTCGGGGTTGACCCA | |||
(531) F: CACAAGCGCCGACTG TC | |||
RIRm (–) R: TTG ACCCGCGCGTACAC | |||
embB306 F: GGCTACATCCTGGGCATG | 392 bp | Ethambutol resistance detection (Yang et al. 2005; Sinha et al. 2019) | |
embBR2 R: GAGCCGAGCGCGATGAT |
The
A single multiplex allele-specific PCR (MAS-PCR) assay was conducted with 10 primers targeting the six most common RIF, INH, and ethambutol (EMB) resistance-conferring mutated codons of the wild-type sequence (Yang et al. 2005; Sinha et al. 2019). Table I lists the 10 allele-specific primers and their targeted codons. First, the primer pairs in the assay were examined in separate PCR reactions to obtain maximum amplification. Then, the concentration of each primer pair in the multiplex reaction was balanced to achieve acceptable amplification of the target regions. Each MAS-PCR reaction mixture contained six forward primers:
Phenotypic drug susceptibility tests (DST) were performed with the final part of the processed sputum specimens to identify drug-resistant MTBC in MBT-sputum-positive samples using automated BACTEC MGIT 960 liquid cultures supplemented with the tested antibiotics according to the recommended protocol. The DST was performed with the standard inhibitory concentrations of INH (0.1 μg/ml), rifampin (1 μg/ml), and ethambutol (2 μg/ml) corresponding to the guidelines of the Clinical Laboratory Standards Institute (CLSI 2018). Culture tubes containing greater than 1% mycobacterial growth in the presence of the inhibitory concentrations of the tested antibiotics compared to growth without the drug were defined as drug-resistant.
Resistance to at least two of the tested antibiotics was defined as MDR-TB. The DST results are expressed as means ± standard deviation from three parallel measurements. Venn-diagram was constructed using InteractiVenn, a web-based tool for the analysis of sets (Heberle et al. 2015).
Of the 48 sputum samples, 25 (52.1%) were positive for BAC-TEC MGIT 960 culture media and MTBC DNA using the GeneXpert MTB/RIF automated system assay. However, only five sputum samples (10.4%) out of the 48 were revealed as smear-positive for acid-fast bacilli by Ziehl-Neelsen stain, whereas the remaining 43 samples (89.6%) were smear-negative. All five samples with smear-positive Ziehl-Neelsen staining were also positive in the BACTEC MGIT 960 and GeneXpert MTB/RIF assays. RIF resistance was detected in four (16%) of the 25
Of the 48 sputum samples, 27 (56.3%) showed a specific positive PCR amplification product (123 bp) using the IS
Polymerase chain reaction amplification of the specific 130 bp fragments with the IS6110 primer pair (panel a) and the specific 152 bp fragments with the
Lanes 2–36 of (panel a) are representative amplified PCR products with the IS6110 primers from selected sputum samples. Lanes 5, 11, 12, 16, 17, 20, 23, 24, 25, 29, and 34 of (panel b) are representative amplified PCR products with the
When the 27 MTBC-confirmed sputum specimens were examined by BACTEC MGIT 960 for the phenotypic drug susceptibility testing, five sputum specimens (18.5%) were identified to be drug-resistant MTBC isolates. Two of the five specimens contained mono-drug-resistant MTBC species toward RIF and EMB, respectively. However, the MTBC species in the remaining three specimens were designated as multi-drug-resistant toward RIF and EMB. The remaining 22 specimens (81.5%) contained susceptible MTBC species toward the tested anti-mycobacterial drugs. All MTBC species in the 27 specimens (100%) were found to be susceptible to INH. Culture-based phenotypic drug susceptibility testing revealed 100% sensitivity agreement with the GeneXpert MTB/ RIF methods in detecting RIF resistance among MTBC species in the sputum specimens.
The multiplex allele-specific PCR assay showed the susceptible characteristic pattern (wild-type allele-specific pattern) with a specificity of 100%, in which drug resistance-conferring mutations were detected in 21 (77.8%) of the 27 MTBC DNA-confirmed samples. Of these 21, two contained resistance mutations towards RIF and 10 towards EMB (including samples 14 and 16 that were not detected by the GeneXpert MTB/RIF methods). The remaining nine showed drug-resistant mutations toward rifampin and ethambutol (Fig. 2a and 2b).
Multiplex-PCR results in 2% agarose gel: the 392 bp product corresponds to
Results show a nonspecific small-size product that links to the amplification of the 170 bp fragment. Lanes M (panels a and b) 100-bp DNA ladder. Lanes 2, 5, 11, 27, 28, and 29 represent sputum samples’ DNA with no mutation at the codons under study. Lanes 12-26 (panel a) and lane 48 (panel b) show
A mutation at codon 306 of the ethambutol (
Rifampin and ethambutol resistance correlated with mutations and their frequency.
Mutations at the
The distribution of mutations associated with rifampin, ethambutol, and isoniazid resistance among MTBC DNA-positive sputum samples.
Genes | ||||||||
---|---|---|---|---|---|---|---|---|
Mutation codons | 516 | 526 | 531 | 306 | 315 | (-15) | 526 | 531 |
No. of isolates | 0 | 3 | 8 | 19 | 0 | 0 | 3 | 6 |
Frequency (%) | 0 | 11.1 | 29.6 | 70.4 | 0 | 0 | 11.1 | 22.2 |
We assessed the sensitivity of the multiplex PCR in detecting RIF, INH, and EMB resistance compared to the GeneXpert MTB/RIF and phenotypic culture-based DST results. Of the 25 MTBC DNA-confirmed samples (excluding the two samples not detected by the GeneXpert MTB/RIF methods), 20 were proven to contain drug-sensitive MTBC isolates, and five contained drug-resistant isolates based on the outcome of the GeneXpert MTB/RIF and phenotypic culture-based DST. Three of the drug-resistant isolates were classified as multi-drug-resistant and two as mono-drug-resistant. Nonetheless, besides the five drug-resistant isolates, drug-resistance-conferring mutations were identified in 14 more samples (a total of 19 samples) using multiplex allele-specific PCR only. The remaining six sputum samples were found to contain non-drug-resistant MTBC when using all the testing methods (Table III). Of the 25 sputum samples with MTBC DNA, nine specimens (36%) showed agreement in results between the multiplex PCR assay, GeneXpert MTB/RIF, and culture-based DST methods. For RIF alone, there were seven discrepant results (28%), all of which contained RIF resistance-conferring mutations but showed sensitivity towards RIF with GeneXpert MTB/RIF and culture-based methods. Also, for EMB alone, there were 12 discrepant results (48%) among the 25 sputum samples that harbor an EMB-resistance conferring mutation using multiplex allele-specific PCR while showing sensitivity to EMB using the culture-based method. Furthermore, five samples out of eight showed discrepant results as they contained allele-specific resistance-conferring mutations for both RIF and EMB. At the same time, the remaining three shared an agreement between multiplex PCR assays and culture-based DST methods. Thus, there were 14 (56%) discrepant results for EMB and RIF among all resistance-detection assays (Fig. 4). All 25 samples showed the absence of discrepant results for INH.
Detailed Venn diagrams showing the number of shared and unique RIF-sensitive MTBC-positive samples (panel a) and RIF-resistant MTBC-positive samples (panel b) among the GeneXpert MTB/RIF, phenotypic culture-based DST, and multiplex PCR assays, and EMB-sensitive MTBC-positive samples (panel c) and EMB-resistant MTBC-positive samples (panel d) among phenotypic culture-based DST and multiplex PCR methods. The numbers under each method in brackets represent the totals detected using that method.
Comparisons between GeneXpert MTB/RIF and culture-based DST with MAS-PCR in detecting drug sensitivity and resistance among MTBC DNA-positive clinical samples.
Sample number | MAS-PCR | GeneXpert | Cult-Bas-DST | ||||
---|---|---|---|---|---|---|---|
RIF | EMB | INH | RIF | RIF | EMB | INH | |
2 | S | S | S | S | S | S | S |
5 | S | S | S | S | S | S | S |
11 | S | S | S | S | S | S | S |
12 | S | S | S | S | S | S | |
17 | S | S | S | S | S | S | |
20 | S | S | S | S | S | S | |
23 | S | S | S | S | S | S | |
24 | S | S | S | S | S | S | |
25 | S | S | S | S | S | S | |
26 | S | S | S | S | S | S | |
27 | S | S | S | S | S | S | S |
28 | S | S | S | S | S | S | S |
29 | S | S | S | S | S | S | S |
30 | S | S | S | S | S | S | |
34 | S | S | S | S | |||
36 | S | S | S | S | S | S | |
37 | S | S | S | S | S | ||
40 | S | S | |||||
41 | S | S | S | S | S | ||
42 | S | S | S | S | S | ||
43 | S | S | S | S | S | ||
44 | S | S | S | S | S | ||
46 | S | S | |||||
47 | S | S | |||||
48 | S | S | S | S | S |
S – drug sensitive; R – drug resistant
A quick and accurate diagnosis is critical for initiating antibiotic therapy and controlling the transmission of pulmonary TB infections. Although molecular line assays, including the GeneXpert, facilitate easy and early identification of TB infections (Opota et al. 2019; Diriba et al. 2021), conventional direct culturing of
The molecular-based GeneXpert system and culture-based BACTEC MGIT 960 assays have proven to be reliable, efficient, safe, rapid, and highly sensitive for detecting mycobacteria (Singh et al. 2016). However, in this study, they detected MTBC in 52.1% (25/48) of the sputum samples with probable TB cases, while the specific PCR assay using the insertion sequence IS
This higher positivity rate of IS
Similar to prior findings, the
Even though the IS
In detecting RIF resistance, the sensitivity of GeneXpert and phenotypic DST was compared with the MAS-PCR assay. Interestingly, MAS-PCR detected resistance-conferring mutations in the
The MAS-PCR assay revealed that resistance-conferring mutations occurring at codon 531 of the
The
Additionally, the MAS-PCR in this study revealed the absence of mutations related to INH resistance in the tested sputum samples. This was in total agreement with the susceptibility results of the culture-based DST, which also showed the absence of drug-resistant MTBC isolates towards INH. According to different studies, the frequency of INH resistance in MTBC shows high variations between different regions of the world (Siddiqui et al. 2019). Data from other studies also showed that the prevalence of INH-resistance varied within the same country, especially those with geographic variability between the central western, eastern southern, and northern regions (Salvato et al. 2019). Although the phenotypic DST assay confirmed the presence of drug-resistant MTBC isolates toward RIF and EMB only, it is still important to be aware of the possible future cross-resistance towards INH, especially among RIF-resistant isolates, as reported previously (Zhang et al. 2021).
Previous research found mutations implicated in RIF resistance inside the target area of the
Future research should focus on integrating next-generation sequencing data, such as whole-genome sequencing data used to diagnose drug-resistant tuberculosis (McNerney et al. 2017; Papaventsis et al. 2017; Gygli et al. 2019), with phenotypic resistance in genome-wide association analyses. This type of integration has proven effective in identifying the heterogeneity among MTBC isolates and uncovering new genetic resistance mechanisms implicated in MTBC resistance to anti-TB medications (Farhat et al. 2019).
It is also imperative that future studies involve the development of novel, easily deployable mycobacterial diagnostic tests that include the detection of additional drug resistance-related targets. Few studies have used luciferase-based ATP bioluminescence assays to monitor extracellular ATP (eATP). Such a technique allows for assessing microbial cell physiological state and calculating viable cell quantity in real time by connecting luminescence onset time to initial cell concentration. Moreover, the same research demonstrated that measuring eATP during bacterial cell death and stress can provide a reliable, sensitive, selective, and quick indication of bacterial susceptibility to antimicrobials, implying that it could replace existing approaches (Khan et al. 2019; Ihssen et al. 2021). In the same context, MTB drug resistance and susceptibility are influenced by redox physiology systems, highlighting the complex connections between anti-TB medications and MTB redox machinery, as well as the possibility of these cellular components as targets for adjunct therapy to existing anti-TB drugs. Furthermore, their distinct expression within the pathogen may represent a novel technique for evaluating antibiotic susceptibility (Pacl et al. 2018).
One limitation of this study was the low number of sputum samples (only 48 samples) with suspected TB infection from the whole region of Al-Madinah city. This occurred because the Kingdom of Saudi Arabia is regarded as a region with very low TB infection incidence (original data) (Alexander et al. 2018). Moreover, most of the samples were collected prior to the annual Islamic pilgrimage (hajj), and in Kingdom of Saudi Arabia, the highest rate of TB-positive sputum samples is detected among none-Saudi patients attending the pilgrimage (hajj) (Alotaibi et al. 2019). Such a high proportion of sputum-positive samples among non-Saudi patients has reassured the authors that an accurate investigation of the carriage was properly undertaken.
The objective of this study was to evaluate the accuracy of results obtained by different methods used for detecting drug-resistant MTBC isolates in the tested sputum samples. In this context, the GeneXpert MTB/ RIF molecular assay considered the gold standard for detecting MTBC-DNA in samples, showed two discordant false-negative results compared with conventional PCR amplification of the insertion sequence IS