Enzootic abortion of ewes (EAE) induced by
The birth of a vital lamb may occur, but these lambs usually cannot survive for more than two days (Spičic et al. 2015). Mice have been widely used and considered helpful animal models for
Diagnosis of EAE can be made with DNA- or protein-based assays (Essig and Longbottom 2015). Lately, conventional and real-time PCRs have mainly been used to detect
The expression and role of the
Monolayers of Vero cells were grown in 25 ml tissue culture flasks at 2 × 106 cells/ml. Confluent monolayers (70–80%) were achieved 24 hours after incubation at 37°C with 5% CO2 with Dulbecco’s Modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (Labiran 2014). About 25 μl of a frozen stored suspension of an aborted ewe’s placental tissue was thawed in SPG (0.25 M sucrose, 10 mM sodium phosphate, and 5 mM L-glutamic acid) and added to Vero cell cultures. Tissue culture flasks were incubated for one hour at 37°C in a saturated humidity environment and 5% CO2. After incubation, DMEM, supplemented with 10% fetal bovine serum and gentamicin (20 μg/ml), was added, and the tissue culture flasks were incubated again at 37°C for 48–72 hours. After 48 hours,
Vero cells were harvested two days after infection with
Thirty-six female and six male albino mice of
The duration of pregnancy was divided into three stages. The first stage was on the 10th day of pregnancy, while stages two and three were after 15 and 20 days. In each stage, six mice were euthanized from each group by intraperitoneal injection of a mixture of xylazine (16 mg/kg) and ketamine (100 mg/kg), followed by cervical dislocation (Schoell et al. 2009).
Following the mice’s euthanasia, the external surface was cleaned and disinfected with 70% ethanol, and the abdomen was opened using aseptic procedures. Fragments were resected from the liver, spleen, lung, kidney, placenta, and fetus. The organ fragments were ground and pooled together. The samples were subjected to RNA extraction using a tissue RNA extraction kit, RT05O (Gene aid, Taiwan). The procedure was conducted following instructions provided by the manufacturer.
RNA measurement was performed using a Nanodrop, ND-8000 (8-sample spectrophotometer, USA). RNA sample absorbance was measured at 230 nm, 260 nm, and 280 nm.
The primer for the
Sequences of the forward and reverse primers of four genes used in Real-time PCR.
Target gene | Primer sequence (5′ to 3′) | Size (bp) |
---|---|---|
Forward: GGGGTCCCAGCTTAGGTTCA |
95 | |
Forward: AAGAAAACCTCTCCCTAGCC |
139 | |
Forward: GCGGCATTCAACCTCGTT |
85 | |
Forward: TCCACTGGGATGATCACCAATA |
81 |
Each reaction was run in a final volume of 20 µl containing 500 ng of the RNA, 1 µl (10 pmol) of each primer, and 10 µl SYBR Green PCR Mastermix (Add Bio/Korea). The amplification profile was 50°C for 20 minutes. Then, at 95°C for 10 minutes, denaturation was followed by 40 cycles of 95°C for 30 seconds and 60°C for 30 seconds.
The RT-qPCR data obtained from the above reaction were analyzed using the comparative CT (2-ΔCT) method, a convenient way to analyze gene expression’s relative changes from real-time quantitative PCR experiments. The Ct values for each gene were first obtained through the RT-qPCR machine used in this study. These values were then imported into a Microsoft Excel file for further calculation and analysis.
The expression levels of mRNAs were normalized to
RT-qPCR data were obtained using the ΔΔ Ct method (fold change mean), normalizing to the reference
mRNA expression levels of the
Wilcoxon signed-rank test analysis of the
Group | Gene type | Period of pregnancy (days) | |
---|---|---|---|
Pregnant group – nonpregnant | 10 |
0.593 |
|
Pregnant group – nonpregnant | 10 |
0.109 |
|
Pregnant group – nonpregnant | 10 |
0.285 |
Moreover, the RT-qPCR analysis also revealed an increase in
The
According to the statistical analyses, there was no statistically significant difference (
In this study, the culturing of
The current study investigated and quantified the expressions of
This method has not been adopted in the Kurdistan and Iraq so far. Combining three gene transcriptomes by RT-qPCR detects virulence factors that might show a substantial role in the pathogenesis of
Chlamydial pathogens have evolved sophisticated mechanisms to elude lytic damage in the host cell (Fields and Hackstadt 2002). As a survival method and equivocation of elimination, chlamydial virulence-associated factors are integrated into the inclusion membrane (Rockey et al. 2002) or secreted into the host cell cytoplasm (Valdivia 2008), which can modulate the host immune reaction.
This difference in the expression of these genes at different time intervals of pregnancy in mice might be due to various causes, for example, technical reasons, sample size, and criteria for evaluating the result. In addition to the bacteria’s virulence characteristics, the host-mediated immune response’s quality and intensity could be responsible for the host specificity of individual species and strains of
It cannot be concluded that the mouse model results are similar to sheep since there are substantial differences in the type of placenta and local immune response. However, it is well known that lymphoid cells in sheep endometrial tissues are morphologically and functionally analogous to pregnant mouse uterus’ granulate material gland cells (Chavan et al. 2016). Our results showed that the different time intervals of pregnancy do not affect the expression of