Marine Sediment Recovered Salinispora sp. Inhibits the Growth of Emerging Bacterial Pathogens and other Multi-Drug-Resistant Bacteria
Kategoria artykułu: original-paper
Data publikacji: 08 wrz 2020
Zakres stron: 321 - 330
Otrzymano: 19 mar 2020
Przyjęty: 25 lip 2020
DOI: https://doi.org/10.33073/pjm-2020-035
Słowa kluczowe
© 2020 Luis Contreras-Castro et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.
The ESKAPE pathogens (Boucher et al. 2009; Pendleton et al. 2013) is an acronym used to designate a group of organisms formed by
Filamentous actinobacteria are well known for their ability to synthetize a great variety of antimicrobial, antifungal, antiviral, and anti-inflammatory molecules (Berdy 2012). Marine ecosystems encompass diverse genera of actinobacteria such as
There is evidence that certain compounds and their associated biosynthetic gene clusters may be fixed at the species level due to a strong selective advantage, which suggests that some secondary metabolites represent ecotype-defining traits for
All media were prepared with artificial seawater (Instant Ocean, USA). These media have been used to characterize and isolate members of the family Micromonosporaceae (Wiese et al. 2008; Maldonado et al. 2009; Maldonado and Quintana 2015; Carro et al. 2019). Isolation plates were incubated at 30°C (IncuMaxTM IC-320 Incubator, Amerex Instruments, Inc., USA) for at least eight weeks. To avoid desiccation, plates were folded using two plastic bags under a humid atmosphere in the incubator. The resulting cultivated actinobacteria were detected and selected based on typical colonial morphology as members of the
Primers for the MLSA amplification.
Gene | Primer sequence (5’-3’) | Product size (bp) | Reference |
---|---|---|---|
ATPDF2 – CTTGCGGTGYATSGACCA | 910 | Rong and Huang 2014 | |
ATPDR3 – GAAGAASGCCTGYTCNGG | |||
GYRBF – GAGGTCGTGCTGACCGTGCTGCACGCGGGCGGCAAGTTCGGC | 781 | ||
GYRBR – ATGGCGGACGCCGACGTCGACGGCCAGCACATCAAC | |||
MYCOF – GGYAAGGTCACSCCSAAGGG | 730 | ||
MYCOR – ARCGGCTGCTGGGTRATC | |||
SECYF – GGCATCATGCCCTACATCAC | 797 | Adekambi et al. 2011 | |
SECYR – AAACCGCCGTACTTCTTCAT |
Characteristics of clinical isolates.
Clinical isolate | Source of infection | Antibiotic resistance |
---|---|---|
Corneal ulcer | Oxacillin, ofloxacin, tobramycin, cefalotin, ceftriaxone, sulfisoxazole | |
Corneal ulcer | Neomycin, gentamicin, ceftazidime, ceftriaxone, tetracycline, sulfisoxazole | |
Corneal ulcer | Norfloxacin, ceftazidime, ceftriaxone, polymyxin B, sulfisoxazole | |
Corneal ulcer | Gentamicin, ceftazidime, ceftriaxone, tetracycline, sulfisoxazole | |
Corneal ulcer | Norfloxacin, ceftazidime, ceftriaxone | |
Conjunctivitis | Ofloxacin, tobramycin, gentamicin, norfloxacin, cefalotin, ceftazidime, tetracycline, sulfisoxazole | |
Endophthalmitis | Oxacillin, tobramycin, gentamicin, ceftazidime, ceftriaxone, tetracycline | |
Endophthalmitis | Ofloxacin, tobramycin, gentamicin, norfloxacin, ceftazidime, ceftriaxone, polymyxin B, tetracycline, sulfisoxazole | |
Hip | Oxacillin, gentamicin, ciprofloxacin, levofloxacin, moxifloxacin, rifampin, trimethoprim-sulfamethoxazole | |
Knee | Oxacillin, gentamicin, ciprofloxacin, levofloxacin, moxifloxacin, tetracycline, rifampin, trimethoprim-sulfamethoxazole | |
Hip | Oxacillin, gentamicin, ciprofloxacin, levofloxacin, moxifloxacin, tetracycline | |
Hip | Oxacillin, gentamicin, ciprofloxacin, levofloxacin, moxifloxacin, erythromycin, clindamycin | |
Hip | Oxacillin, gentamicin, ciprofloxacin, levofloxacin, moxifloxacin, tetracycline, trimethoprim-sulfamethoxazole | |
Hip | Oxacillin, gentamicin, ciprofloxacin, levofloxacin, moxifloxacin, tetracycline, trimethoprim-sulfamethoxazole | |
Hip | Oxacillin, ciprofloxacin, levofloxacin, moxifloxacin, clindamycin | |
Hip | Oxacillin, ciprofloxacin, levofloxacin, moxifloxacin | |
Hip | Oxacillin, gentamicin, ciprofloxacin, levofloxacin, moxifloxacin, erythromycin, clindamycin | |
Hip | Oxacillin, gentamicin, ciprofloxacin, levofloxacin, moxifloxacin | |
Urine sample | Ceftazidime, ceftriaxone, cefepime, doripenem, etapenem, meropenem, | |
imipenem, amikacin, gentamicin, ciprofloxacin, rifamycin | ||
Wound infection | Ceftazidime, ceftriaxone, cefepime, doripenem, etapenem, meropenem, imipenem, amikacin, gentamicin, ciprofloxacin, rifamycin | |
Blood sample | Piperaciline, ceftazidime, ceftriaxone, cefepime, doripenem, etapenem, meropenem, imipenem, amikacin, gentamicin, ciprofloxacin, rifamycin | |
Blood sample | Piperaciline, ceftazidime, ceftriaxone, cefepime, doripenem, etapenem, meropenem, imipenem, amikacin, gentamicin, ciprofloxacin, rifamycin | |
Wound infection | Oxacillin, gentamicin, ciprofloxacin, erythromycin, clindamycin, tetracycline, trimethoprim-sulfamethoxazole, penicillin, rifamycin | |
Urine sample | Erythromycin, clindamycin, tetracycline, penicillin, rifamycin |
Using the ISP media and based on the abundance of spore production, two different groups of salinisporae were formed (Appendix 1). The alignment analysis of the 16S rRNA gene sequences using BLAST showed that the closest genetic neighbors of the forty-two strains belonged to the genus
Fig. 1.
The Bayesian inference tree of 1,175 bp of the 16S rRNA gene sequences from strains that composed the genus

Fig. 2.
The Bayesian inference tree of the 4,349 bp concatenated gene sequences (16S rRNA-

Fig. 3.
The inhibition of the growth of
a) the

A third assay for testing
Since the release and analysis of the whole genome sequencing of
The preliminary characterization of the isolates recovered on ISP media 1 to 7 showed their high phenotypic heterogeneity. According to the spore production, two groups were formed. It is known that several secondary metabolites are expressed during germination (Cihak et al. 2017); thus, a difference in spore formation might lead to a different metabolic potential. Seventy-one out of seventy-five isolates required marine seawater for growth hence suggesting their assignment to the genus
Although the 16S rRNA gene sequencing grouped the isolates to
The MLSA was well supported by the individual phylogeny of each gene fragment, and the phylogeny of the
The studies of
The bacterial species used in the present work, like members of the ESKAPE group, are listed as priority organisms by the World Health Organization (WHO 2017). They are resistant to a whole range of commercial antibiotics, and there is a global initiative to discover, research, and develop new antibiotics to fight this multi-drug-resistant bacteria. To our knowledge, our report is one of the first in this area and was designed for searching
Punta Arena de la Ventana is the furthest South Point of the GC ever studied and seemed to contain a high diversity of