Bovine viral diarrhoea virus (BVDV) and bovine herpesvirus-1 (BoHV-1) infections are common in cattle populations worldwide. The cytopathogenic and non-cytopathogenic biotypes of BVDV, which is in the
Like BVDV and BoHV-1, bovine herpesvirus-4 (BoHV-4) has been reported to be among the causative agents of reproductive or respiratory system disorders characterised by infertility, abortion, repeat breeding, respiratory distress, and neonatal calf mortality (5, 10). As a gammaherpesvirus, it exhibits latency in monocyte/ macrophage lineage cells. This virus also plays a cofactor role in the escalation of clinical episodes and the extension of recovery periods in cases of postpartum metritis and mastitis caused by the primary bacterial agents such as
A microorganism-related inflammation of the mammary glands or quarters, mastitis is a major problem that negatively affects dairy cattle worldwide and has serious economic repercussions. The primary causes of mastitis are a wide range of bacterial species (2); however, it has been reported that foot and mouth disease virus, parainfluenza virus-3, BVDV, BoHV-1 and BoHV-4 have also been isolated from cases of natural clinical mastitis (7, 19, 20, 28). If the suffering animal’s immunological activity is reduced or the virulence of the pathogenic microorganisms is high, a partially eliminated infection may persist for a longer time, often presenting as subclinical or chronic mastitis (21). Bovine immunodeficiency virus, bovine leukaemia virus, BVDV and BoHV-1 infections in particular may play indirect roles in bovine mastitis through immunosuppression (28). Although BoHV-4 is not a direct mammary pathogen, it has been shown to reach the mammary epithelium after an inflammatory process in the mammary tissues and replicate both in the mammary epithelium and in the immune cells in the udder (2, 3, 19).
Humoral immune components such as immunoglobulins A and G are critical to the immunological defence response of the cow udder (21). Some studies reported that udder inflammation affects the concentration of immunoglobulins in serum and milk, and there are many factors that regulate and affect the mammary–blood barrier, which determines the migration of immunoglobulins from the bloodstream to the mammary gland tissue (9, 21, 23).
In this study, we aimed not only to correlate anti-BVDV, anti-BoHV-1 and anti-BoHV-4 antibody levels in serum and milk from clinically mastitic dairy cattle but also to determine the presence of and characterise genetically BoHV-4 in clinical mastitis cases in these animals.
The sera were diluted 1 : 5 for BVDV, 1 : 2 for BoHV-1, and 1 : 100 for BoHV-4 antibodies, while the milk samples were tested without dilution. At the end of all three tests, optical density values were read using an ELISA reader (BioTek μQuant; BioTek Instruments, Winooski, VT, USA) at the 450 nm wavelength.
Primers used in PCR for detection of BoHV-1 and BoHV-4
Virus | Target gene/amplicon size (bp) | Primers | Sequence (5′–3′) | Reference |
---|---|---|---|---|
BoHV-1 | PF1 | CGGCCACGACGCTGACGA | (15) | |
PF2 | CGCCGCCGAGTACTACCC | |||
BoHV-4 | gB1 | CCCTTCTTTACCACCACCTACA | (29) | |
gB2 | TGCCATAGCAGAGAAACAATGA |
bp – base pairs; BoHV – bovine herpesvirus;
A commercial master mix solution (5× HOT FIREPol Blend PCR Master Mix; Solis BioDyne, Tartu, Estonia) including Hot FIREPol DNA polymerase as a proofreading enzyme, 5× blend master mix buffer, 15 mM MgCl2, 2 mM dNTPs, bovine serum albumin, blue dye and yellow dye was used in the amplification stage of both viruses. Amplification was performed in a 20 μL reaction mixture by adding 2 μL of template DNA to 18 μL of PCR master mix containing a final concentration of 0.5 μM of each primer. The amplification programme for BoHV-1 and BoHV-4 was: an initial denaturation at 95°C for 15 min followed by 35 cycles consisting of denaturation at 95°C for 20 s, annealing at 56°C for 1 min and extension at 72°C for 1 min. The reaction was terminated after a final hold at 72°C for 7 min. All PCR products were visualised in a transilluminator after electrophoresis in 1% agarose gel containing Safe-Red DNA stain (SafeView cat no. G108-R; Applied Biological Materials, Richmond, BC, Canada).
The amplified BoHV-4 DNA products were sequenced using an automatic sequence genetic analyser (CEQ 8000; Beckman Coulter, Brea, CA, USA) by a commercial company (BM Lab, Ankara, Türkiye). The gB sequence assembly and editing were performed using Bioedit (Version 7.0.5.3) (17). A phylogenetic tree was created with different BoHV-4 strains using the neighbour-joining method as implemented in Clustal W in MEGA 7.0 software (22). The bootstrap values were calculated from 1,000 replicates.
For BVDV antibodies, there was a statistically significant difference in S/P indices between the blood and milk samples, regardless of health status (P < 0.001). Evaluating blood and milk samples together, a statistically significant difference in S/P indices existed between healthy and sick animals (P = 0.003). Nevertheless, there was no statistically significant difference between healthy and mastitic cattle in terms of blood-to-milk transition levels (P = 0.156).
For BoHV-1 antibodies, a statistically significant difference was observed in PP between blood and milk samples, regardless of health status (P < 0.001). Analysing blood and milk samples together, a statistically significant difference emerged between healthy and sick animals in terms of PP values (P < 0.001). Additionally, blood-to-milk transition levels were higher among sick animals than healthy ones (P < 0.001) (Table 2 and Fig. 1).
Bovine viral diarrhoea virus (BVDV) and bovine herpesvirus-1 (BoHV-1) levels in serum and milk taken from cattle with clinical mastitis and healthy cattle
P-values |
||||||||
---|---|---|---|---|---|---|---|---|
Virus | State of health | Serum mean ± SD | ELISA cut-off | Milk mean ± SD | ELISA cut-off | Sample | State of health | Sample × state of health |
Healthy | 90.24±3.74a,A | 80.66±6.99b,A | ||||||
BVDV | Mastitic | 94.71±1.39a,B | ≥35% | 93.76±2.87b,B | ≥0.3 | <0.001 | 0.003 | 0.156 |
Healthy | 90.24±3.74a,A | 80.66±6.99b,A | ||||||
BoHV-1 | Mastitic | 94.71±1.39a,B | ≥35% | 93.76±2.87b,B | ≥25% | <0.001 | <0.001 | <0.001 |
SD – standard deviation; a, b – lower case superscripts indicate statistically significant difference between serum and milk samples; A, B – upper case superscripts indicate statistically significant difference between the samples from cattle with clinical mastitis and healthy cattle
The Bland–Altman analysis revealed a bias of 1.19 in anti-BVDV antibodies and 9.58 in anti-BoHV-1 antibodies between serum and milk samples from healthy cows. In cows with mastitis, there was a bias of 1.42 in anti-BVDV antibodies and 0.94 in anti-BoHV-1 antibodies between serum and milk. A statistical agreement between milk and serum samples was only found for BoHV-1 in cattle with clinical mastitis. The interpretation values of the milk and serum samples were markedly higher than the cut-off values for BoHV-1 in the healthy group and for BVDV in both groups. Therefore, it would be correct to consider the serum and milk samples to be clinically consistent (Figs 2 and 3).
Antibodies specific to BoHV-4 were only detected in the group with clinical mastitis. Also, anti-BoHV-4 antibody levels were higher in milk than in sera obtained from dairy cattle with clinical mastitis. For BoHV-4, the differences between serum and milk samples in PP and seropositivity degree were statistically significant (P < 0.001) (Table 3). The Bland–Altman plot showed a bias of 34.79 in BoHV-4 (Fig. 4).
Bovine herpesvirus-4 (BoHV-4) levels in serum and milk samples collected from cattle with clinical mastitis
Sample |
|||||
---|---|---|---|---|---|
Serum | Milk | ELISA cut-off | P-value | ||
BoHV-4 positivity rate (%) | Mean ± SD | 110.85 ± 34.39 | 145.64 ± 51.75 | ≥30% | <0.001 |
BoHV-4 positivity degree* | Mean ± SD | 3.15 ± 1.05 | 3.97 ± 1.08 | ||
Median (min–max) | 3 (1–5) | 4 (2–5) | <0.001 |
* – degree of positivity for sera and milk: +1 is ≥30%–<60%, +2 is ≥60%–<90%, +3 is ≥90%–<120%, +4 is ≥120%–<150%, and +5 is ≥150%
In the present study, we detected BVDV-, BoHV-1-,and BoHV-4-specific antibodies in all serum and milk samples. Bovine viral diarrhoea virus- and BoHV-1-specific antibody titres were well above the cut-off positivity values in both blood and milk, and this extent of antibody production was thought to be vaccine induced, since both herds had been vaccinated regularly and recently against BVDV and BoHV-1. Moreover, the antibody titres to BVDV and BoHV-1 exhibited good correlation in both individual serum and milk as described elsewhere (4, 24), although the titres were relatively lower in milk than in serum from all cattle in our groups. Similarly, it was reported that the anti-BVDV antibody titre was lower in milk than in serum in relation to the lactation period (23). Data for the lactation period was not obtained in the present study, and detailed studies are needed to evaluate the effect of this factor on the correlation between antibody titres in milk and serum.
Anti-BoHV-4 antibodies were detected only in the clinical mastitis group, and virus nucleic acid was detected in the milk samples of four antibody-positive animals by PCR. Interestingly, the cases of clinical mastitis within the same herd were caused by different BoHV-4 genotypes, and virus was also detected in milk despite the presence of antibodies. It should be emphasised that the protection of virus-specific antibodies is controversial (12), and the status of infection as latent, acute or reinfection was difficult to determine in these cattle. However, anti-BoHV-4 antibody levels were higher in milk than in sera sampled from dairy cattle with clinical mastitis. This agrees with the results of a previous study comparing Schmallenberg virus antibody levels in serum and milk (11). We believe that the differences in serum-to-milk antibody transition levels were due to the passive transport of inactivated vaccine-derived BVDV- and BoHV-1-specific antibodies to the mammary tissue, whereas antibodies against BoHV-4 might be production triggered by natural infection. Several studies have reported that immunoglobulins in lacteal secretions are produced locally by plasma or epithelial cells in the mammary gland and are transferred passively from blood to the udder as a result of the blood–mammary barrier being compromised during mastitis (7, 13, 16, 18, 19, 28). However, there is an increase in BoHV-4 prevalence with increased lactation stage, lactation number, sex, age, management type, and post-partum metritis (1, 6, 14). In this study, the mean lactation stage for animals with clinical mastitis was 2.19 ± 1.28, the mean age 50.40 ± 17.09 months, and the management type intensive farming, all of which may have greatly increased the probability of exposure to BoHV-4 infection. Information on the lactation period could not be obtained for either herd. Although a previous study also reported the presence of BoHV-4 in healthy cattle (19), we made no such finding. The high biosafety standards may have been instrumental in preventing any detectable BoHV-4 presence, given that the herd was free of many important diseases such as brucellosis, tuberculosis, or enzootic bovine leucosis. Alternatively, this finding may be related to the small number of samples.
Many pathogens have been reported to infect the udder
The findings of the present study indicate that clinical mastitis cases in the same herd may have aetiology in different BoHV-4 genotypes. Moreover, since individual serum and milk antibody titres showed good correlation in this study, preventive vaccinations against microbial agents such as BVDV, BoHV-1,