The discovery of antimicrobials has improved the quality of life of both humans and animals. Antimicrobials reduce mortality and morbidity by supporting recovery from surgical interventions and preventing diseases in immunocompromised patients, and they increase the lifespan of domestic animals or optimise animal production. However, inappropriate use of antibiotics exerts selective pressure on bacteria. The end result of this pressure is antimicrobial resistance (AMR) rising to levels which, for some infections previously easily treated, presently leave clinicians no treatment options (33).
Certain bacteria have developed a natural way to resist biomolecules produced by other microorganisms (33). Consequently, they contain a wide range of genes and genetic determinants of resistance naturally acquired that may be transmitted to other bacteria, including human and animal pathogens (12), leading to a decrease in or a complete loss of antibiotic efficacy.
Antimicrobial resistance is considered by the World Health Organization (WHO) “one of the top 10 global public health threats facing humanity” (34). The Tripartite Alliance between the WHO, the World Organisation for Animal Health (OIE), and the Food and Agriculture Organization of the United Nations (FAO) exists to address important health problems, such as AMR, and to promote awareness, investigation and cooperation between countries and health professionals (13). One of its proposals is the monitoring of resistance in sentinel bacteria such as the vancomycin-resistant
The end of bacterial susceptibility to antimicrobials is a global anthropogenic threat affecting humans, animals and the environment, the last of these being regarded as an important vehicle of the transmission of AMR (18). Rectifying the lack of studies assessing the spread of AMR in wildlife, this study aimed to investigate the resistance to antibiotics of
Species of wild mammals included in the study classified by origin, main diet and scavenging habit together with number of
Mammal order | Species | Scientific name | Origin | Main diet | Scavenging habit** | Individuals (n) | Isolates (n) |
---|---|---|---|---|---|---|---|
Artiodactyla | Iberian ibex | CWFR-LA | Herbivorous | No | 1 | 0 | |
Mouflon | Hunting | Herbivorous | No | 4 | 4 | ||
Red deer | Hunting | Herbivorous | No | 9 | 10 | ||
Roe deer | CWFR-LA | Herbivorous | No | 1 | 2 | ||
Wild boar | Hunting | Omnivorous | No | 17 | 16 | ||
Total | 32 | 32 | |||||
Carnivora | American mink | CWFR-LA | Carnivorous | Yes | 6 | 11 | |
Badger | CWFR-LA | Omnivorous | Yes | 3 | 6 | ||
Beech marten | CWFR-LA | Carnivorous | Yes | 2 | 4 | ||
Common genet | CWFR-LA | Carnivorous | Yes | 1 | 2 | ||
Common otter* | CWFR-LA | Piscivorous | Yes | 3 | 8 | ||
Red fox | CWFR-LA | Carnivorous | Yes | 3 | 3 | ||
Weasel | CWFR-LA | Carnivorous | Yes | 1 | 0 | ||
Total | 19 | 34 | |||||
Chiroptera | European bat free-tailed | CWFR-LA | Insectivorous | No | 1 | 2 | |
Total | 1 | 2 | |||||
Erinaceomorpha | Hedgehog | CWFR-LA | Insectivorous | No | 11 | 24 | |
Total | 11 | 24 | |||||
Lagomorpha | Wild rabbit | Hunting | Herbivorous | No | 38 | 33 | |
Granada hare | Hunting | Herbivorous | No | 2 | 1 | ||
Total | 40 | 34 | |||||
TOTAL | 16 | 103 | 126 |
* – one enterococcus isolated from a common otter was missing after identification; **– occasional carrion eaters were excluded; CWFR – Centre of Wild Fauna Recovery of La Alfranca (Aragón, Spain)
The epidemiological data compiled were the order and species, source of sampling, animal age (infant (<1 year), young (from 1 to 2 years) or adult (>2 years)), sex, main diet (apart from the general consideration, the main diet is the one most frequently ingested by the mammal: carnivorous, herbivorous, omnivorous, piscivorous, or insectivorous), and scavenging (if habitual on carrion or not). The year and season of sampling and the geographical location of the mammal’s hunting or rescue were also recorded.
Primers and conditions for detecting
Primers (5′—>3′) | Amplification | Reference (length of the amplicon) |
---|---|---|
96°C2 min, 1 cycle | ||
94°C30 s | ||
50°C30 s, 35 cycles | Woodford |
|
F: ATGGCAAGTCAGGTGAAGATGG | 72°C1 min | (399 bp) |
R: TCCACCTCGCCAACAACTAACG | 72°C10 min, 1 cycle | |
94°C3 min, 1 cycle | ||
94°C30 s | ||
F: CAAAGCTCCGCAGCTTGCATG | 58°C2 min, 40 cycles | Dahl |
R: TGCATCCAAGCACCCGATATAC | 72°C2 min | (484 bp) |
72°C6 min, 1 cycle |
The DD test reading was based on the criteria set by the CLSI. In the case of the M.I.C. Evaluator test, the manufacturer provides the range of concentrations of antibiotics to distinguish resistant, intermediate and susceptible bacteria, also based on CLSI criteria. Multidrug-resistant (MDR) isolates were defined as those not susceptible to at least one agent in three or more antimicrobial categories (22).
One hundred and twenty-six enterococci isolates were recovered, 64 from hunted mammals and 62 from rescued mammals. The enterococci were collected from 14 species as listed in Table 1. No enterococci were retrieved from Iberian ibex and weasel samples, while all hedgehog samples carried these bacteria.
The frequency of the isolates was similar among orders. The Lagomorpha and Carnivora provided 34 enterococci isolates each (26.98% of the total enterococci retrieved), Artiodactyla yielded 32 (25.40%), and Erinaceomorpha gave 24 (19.05%). The single representative of the Chiroptera carried two enterococci (1.59%). Considering the main diet, herbivores provided 50 isolates, (39.68% of the total isolates), insectivores 26 isolates (20.63%), omnivores 22 isolates (17.46%), carnivores 20 isolates (15.87%), and piscivores 8 isolates (6.35%) (Table 1).
Seven different
When comparing the prevalence of
Frequency of
Isolates (n) | Isolates (%) | Resistance to QD n (%) | ||
---|---|---|---|---|
47 | 37.60 | 38 (80.85) | ||
26 | 20.63 | 8 (30.77) | ||
22 | 17.46 | 12 (54.55) | ||
13 (−1) | 9.60 | 9 (75.00) | ||
9 | 7.14 | 5 (55.56) | ||
8 | 6.35 | 6 (75.00) | ||
1 | 0.79 | 1 (100.00) | ||
TOTAL | 125* | 100 | 79 (63.20) | |
Species Order | Isolates (n) | Isolates (%) | Resistance to QD n (%) | P value for associations |
Artiodactyla | 32 | 25.60 | 11 (34.38) | Lag. |
Carnivora | 33 | 26.40 | 20 (60.61) | Carn. |
Chiroptera | 2 | 1.6 | 2 (100.00) | |
Erinaceomorpha | 24 | 19.2 | 16 (66.67) | Erin. |
Lagomorpha | 34 | 27.2 | 30 (88.24) | |
Age | P value for associations | |||
Adult | 70 | 56.00 | 37 (52.86) | Young |
Young | 50 | 40.00 | 38 (76.00) | |
Infant | 5 | 4.00 | 4 (80.0) | Not applicable |
TOTAL | 125* | 100 | 79 (63.20) |
Art. – Artiodactyla; Car. – Carnivora; Erin. – Erinaceomorpha; Lag. – Lagomorpha; QD – quinupristin-dalfopristin; * – A total of 126 isolates were retrieved. However, one of the enterococci identified as
Results of the statistical analysis of
Factor | Variable (n) | P value* | ||
---|---|---|---|---|
Source of sampling | CWFR-LA (36) | 19 (52.78) | 17 (47.22) | |
Hunting (33) | 28 (84.85) | 5 (15.15) | 0.0025 | |
Age | Adult (32) | 15 (46.88) | 17 (53.13) | 0.0009 |
Young (32) | 27 (84.38) | 5 (15.63) | ||
Infant (5) | 5 (100.00) | 0 | Not applicable | |
Sex** | Female (29) | 25 (86.21) | 4 (13.79) | F 0.0078 |
Male (39) | 22 (56.41 | 17 (43.59) | ||
Main diet | Carnivorous (15) | 8 (53.33) | 7 (46.67) | 0.0152 |
Herbivorous (33) | 28 (84.85) | 5 (15.15) | ||
Scavenging habit | No (48) | 36 (75.00) | 12 (25.00) | |
Yes (21) | 11 (52.38) | 10 (47.62) | 0.0383 |
CWFR – Centre of Wild Fauna Recovery of La Alfranca (Spain); F – Fisher’s exact test; * – χ2 or Fisher’s test where appropriate; statistical significance at P < 0.05; ** – one animal did not have its sex determined
The highest frequency of resistance to QD was identified for
According to the DD test, the percentage of VAN
As seen in Table 5, the highest frequency of enterococci resistance to antibiotics was for QD (63.20%) and the lowest for AMP (7.20%), with frequencies of some concern also emerging for CIP, TE, ERI and S.
Frequency of
Species | Antibiotic tested |
|||||||||
---|---|---|---|---|---|---|---|---|---|---|
AMP | CL | CIP | ERI | GEN | QD | S | TE | |||
American mink | 11 | 8.80 | 3 | 9 | 4 | 2 | 6 | 3 | 8 | |
Badger | 6 | 4.80 | 1 | 3 | 2 | 1 | 4 | 3 | 4 | |
Beech marten | 4 | 3.20 | 2 | 2 | 3 | 2 | 1 | 2 | 3 | |
Common genet | 2 | 1.60 | 2 | 2 | 2 | |||||
Common otter | 7 | 5.60 | 2 | 5 | 4 | 5 | 3 | 3 | ||
European free-tailed bat | 2 | 1.60 | 1 | 1 | 2 | |||||
Granada hare | 1 | 0.80 | 1 | |||||||
Hedgehog | 24 | 19.20 | 2 | 9 | 6 | 2 | 16 | 4 | 10 | |
Mouflon | 4 | 3.20 | 1 | 1 | 1 | |||||
Red deer | 10 | 8.00 | 1 | 4 | 4 | 2 | 3 | |||
Roe deer | 2 | 1.60 | 1 | 1 | 2 | 1 | 2 | 2 | 2 | |
Red fox | 3 | 2.40 | 1 | 2 | 1 | 1 | 2 | 1 | 2 | |
Wild boar | 16 | 12.80 | 3 | 1 | 7 | |||||
Wild rabbit | 33 | 26.40 | 1 | 2 | 22 | 6 | 5 | 29 | 6 | 4 |
TOTAL N |
125 | 100 | 9 | 12 | 65 | 32 | 11 | 79 | 25 | 41 |
100 | 7.20 | 9.60 | 52.00 | 25.60 | 8.80 | 63.20 | 20.00 | 32.80 |
AMP – ampicillin; CL – chloramphenicol; CIP – ciprofloxacin; ERI – erythromycin; GEN – gentamicin; QD – quinupristin-dalfopristin; S – streptomycin; TE – tetracycline. No enterococci resistant to any of the studied antibiotics were recovered from the Iberian ibex or weasel
Regarding the mammal species (Table 5), the lowest frequency of bacteria resistant to CIP was found in wild boar (18.75%; 3/16); however, the scarcity of resistant isolates from these mammals detracts from the reliability of the results. Wild rabbits carried enterococci with the highest percentage of resistance to CIP (66.67%; 22/33), and the difference to the percentage with resistance among isolates from hedgehogs (37.50%; 9/24) was significant (P = 0.0172). As regards resistance to TE, its frequency in wild rabbit isolates (12.12%; 4/33) was significantly lower than that in hedgehog (41.67%; 10/24), and red and roe deer isolates (41.67%; 5/12). The number of
Regarding the source of samples (Table 6), it was observed that the rescued mammals carried enterococci with higher levels of resistance, except to AMP, CL, CIP and GEN, for which the results were not significant. The highest frequencies of resistant isolates in rescued mammals were observed for TE (55.74%), ERI (34.43%) and S (29.51%).
Antibiotic resistance of
Factor | Antibiotic | Factor category (n) | Antibiotic resistance n (%) | P value* |
---|---|---|---|---|
Source of samples | ERI | CWFR-LA (61) | 21 (34.43) | 0.0149 |
Hunting (64) | 11 (17.19) | |||
S | CWFR-LA (61) | 18 (29.51) | 0.0024 | |
Hunting (64) | 6 (9.38) | |||
TE | CWFR-LA (61) | 34 (55.74) | 0.0000 | |
Hunting (64) | 7 (10.94) | |||
Order | CIP | Artiodactyla (32) | 9 (28.13) | 0.0018 |
Carnivora (33) | 24 (72.73) | |||
Erinaceomorpha (24) | 9 (37.50) | |||
Lagomorpha (34) | 22 (64.71) | |||
Chiroptera (2) | 1 (50.00) | |||
TE | Artiodactyla (32) | 5 (15.63) | 0.0000 | |
Carnivora (33) | 22 (66.67) | |||
Erinaceomorpha (24) | 10 (41.67) | |||
Lagomorpha (34) | 4 (11.76) | |||
Chiroptera (2) | 0 | Not applicable |
CIP – ciprofloxacin; ERI – erythromycin; S – streptomycin; TE – tetracycline; * – χ2, statistical significance at P < 0.05. Only statistically significant associations are included
There was an association between order and resistance to CIP (P = 0.0002) and TE (P = 0.0000),
Female mammals (Table 7) showed the highest percentage of isolates resistant to CIP (64.58%; 31/48) (P = 0.0228). Concerning the main diet, no statistical significance was identified for resistance to CL or GEN; none of the 22 isolates achieved from omnivorous mammals was resistant to CL. Overall, the carnivorous and piscivorous animals yielded the highest percentages of isolates resistant to most of the studied antibiotics and the herbivorous and omnivorous species isolates showed the lowest percentages of resistance. The frequency of resistant isolates to CIP obtained from the carnivores was significantly higher than that of the omnivores, and a similar disparity was observed for resistance to TE. In this case, there was also significance to the differences in frequency of resistance between enterococci isolated from herbivores (18.00%) and those isolated from insectivores (38.46%). A scavenging habit was associated with a higher percentage of resistant isolates to CIP (72.73%), TE (66.67%), ERI (39.39%), S (36.36%), CL (18.18%) and AMP (18.18%) compared to those eating no carrion (P ≤ 0.005)
Antibiotic resistance of
Factor | Antibiotic | Factor category (n) | Antibiotic resistance n (%) | P value* |
---|---|---|---|---|
CIP | Female (48) | 31 (64.58) | 0.0096 | |
Sex | Male (75) | 32 (42.67) | ||
Female (48) | 8 (16.67) | |||
GEN | Male (75) | 3 (4.00) | F 0.0200 | |
AMP | Carnivorous (20) | 5 (25.00) | F 0.0376 | |
Herbivorous (50) | 3 (6.00) | |||
Carnivorous (20) | 16 (80.00) | Carn. |
||
Herbivorous (50) | 28 (56.00) | |||
CIP | Insectivorous (26) | 10 (38.46) | ||
Main diet | Omnivorous (22) | 6 (27.27) | ||
Piscivorous (7) | 5 (71.43) | |||
Carnivorous (20) | 15 (75.00) | Carn. |
||
TE | Herbivorous (50) | 9 (18.00) | Carn. |
|
Insectivorous (26) | 10 (38.46) | Carn. |
||
Omnivorous (22) | 4 (18.18) | Ins. |
||
AMP | No (92) | 3 (3.26) | F 0.0104 | |
Yes (33) | 6 (18.18) | |||
CL | No (92) | 6 (6.52) | 0.0368 | |
Yes (33) | 6 (18.18) | |||
No (92) | 41 (44.57) | |||
Scavenging habit | CIP | Yes (33) | 24 (72.73) | 0.0029 |
No (92) | 19 (20.65) | |||
ERI | Yes (33) | 13 (39.39) | 0.0215 | |
No (92) | 12 (13.04) | |||
S | Yes (33) | 12 (36.36) | 0.0032 | |
TE | No (92) | 19 (20.65) | 0.0000 | |
Yes (33) | 22 (66.67) |
AMP – ampicillin; CIP – ciprofloxacin; CL – chloramphenicol; ERI – erythromycin; GEN – gentamicin; S – streptomycin
In this study, a total of 27 isolates were classified as MDR (21.60%; 27/125). The higher percentage of MDR isolates was found in isolates from rescued mammals (32.26%; 20/62), and greatly exceeded the low proportion obtained from isolates from hunted mammals (11.11%; 7/63). The Carnivora order carried more MDR enterococci (39.39%; 13/33) than the Artiodactyla (6.25%; 2/32). Carrion eaters also gave a higher percentage of MDR isolates (39.39%; 13/33), than animals which did not scavenge for it (15.22%; 14/92). All these differences were statistically significant (P ≤ 0.005). Regarding the animal species, it was not possible to perform any statistical analysis because of the low number of isolates obtained from the majority of them. It is of note that none of the 16 isolates achieved from wild boar was MDR, while 1 out of the 2 isolates from the European free-tailed bat and 2 out of the 4 isolates from beech martens were.
Enterococci are found as part of the gastrointestinal microbiome in humans and animals (mammals, birds, fish, reptiles and insects) (25), in nosocomial infections (31), and in soil, plants, water and sewage (5). We identified enterococci from all samples from hedgehogs, which could be related to their predominantly insect diet (15), suggesting that the environment is involved. Wild animals should be studied as an important component of the environment in order to assess the expansion of AMR, since they are not directly treated with antibiotics. Research on wild fauna also gives a picture of the magnitude of this healthcare problem (9, 16, 24).
One of the main hindrances to treatment of enterococci infections is resistance to widely used antibiotics (17), and it is of note that resistant enterococci have the ability to easily exchange AMR genes with other enterococci and Gram-positive bacteria species (5). The highest level of resistance detected in this study was to QD, this level being higher than those found by other authors (29). Quinupristin-dalfopristin is a combination of two synthetic streptogramins developed to treat VRE and MDR
Resistance to CIP was also high in isolated enterococci, showing a similar prevalence to that observed in isolates from domestic mammals (19, 24). The mammal species which provided the isolates demonstrating the greatest CIP-resistance in this study were American mink, common otters and beech martens. A high prevalence of resistance to CIP was observed in carnivore, piscivore and female mammal isolates, suggesting the presence of interacting factors. Fluoroquinolones such as ciprofloxacin are frequently used together with β-lactams or vancomycin to treat human infections caused by
Resistance to TE, ERI and S was also high in this study. Mammal feeding habits might contribute to this resistance and resistance to other antibiotics, implying a variety of sources for its acquisition and the importance of the agricultural environment (20, 24). The highest frequency of resistance to TE was detected in
In general, resistance to ampicillin is frequent in
In this study, the DD test gave false positives for resistance to VAN and TEI, indicating its low reliability. As other authors found, the M.I.C. Evaluator test is the most suitable technique to detect resistance to vancomycin, but results need to be confirmed by molecular techniques (especially to identify
The main limitation of this study is the number of species included in the final analysis: because samples needed to originate from wild mammals, this criterion imposed conditions on obtaining samples and made it difficult. Further studies concomitantly testing human, animal and environmental sources (rivers, waste water, soil and plants) are required in order to assess the extent of the dissemination of bacterial resistance and AMR determinants.
In conclusion, resistance to antibiotics with sanitary implications was detected in a high percentage of enterococci isolated from wild mammals in the Autonomous Community of Aragón, Spain. The results of this study suggest that animal medication, where administered in animal husbandry, agriculture and livestock production; human medication; and both, where residues of therapeutic antimicrobials may contaminate rivers, soil and vegetation, are pathways for resistance genes to reach bacteria in wild mammals. This implies that efforts to control AMR might tackle this problem perceiving it from a wider perspective, extending to particular study and monitoring of the environment in order to avoid the dissemination of AMR, as the global health concept proposes.