Attempts at the development of a recombinant African swine fever virus strain with abrogated EP402R, 9GL , and A238L gene structure using the CRISPR/Cas9 system
Data publikacji: 03 cze 2020
Zakres stron: 197 - 205
Otrzymano: 04 paź 2019
Przyjęty: 25 maj 2020
DOI: https://doi.org/10.2478/jvetres-2020-0039
Słowa kluczowe
© 2020 G. Woźniakowski et al. published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.
Fig. 1

Fig. 2

Fig. 3

Fig. 4

Results of conventional PCR
Material | PCR target | |||
---|---|---|---|---|
KO-9GL1 | (2)− | n/a | n/a | (5)− |
KO-9GL2 | (3)− | n/a | n/a | (6)+ |
KO-A238L1 | n/a | (8)+ | n/a | (11)+ |
KO-A238L2 | n/a | (9)+ | n/a | (12)+ |
KO-EP402R1 | n/a | n/a | (14)− | (17)+ |
KO-EP402R2 | n/a | n/a | (15)− | (18)− |
WT | (4)+ | (10)+ | (16)+ | (7, 13, 19)+ |
Transfection protocol_ The main conditions for two applied kits are presented
Parameter | Xfect | GeneJect |
---|---|---|
Plasmid DNA | 5 μg | 0.4 μg |
Total growth medium volume | 1,000 μL | 1,000 μL |
Transfection reagent | 1.5 μL | 2 μL |
Incubation time for nanocomplexes creation | 10 min/RT | 30 min/RT |
Incubation time with target cells | 4 h/37°C | 24–72 h/37°C |
Additional steps | Disposal Replacement of medium with fresh growth medium | - |
Control of transfection effect | 48 h | Within 24–72 h incubation time |
Target DNA sequences of A238L, EP402R, and 9GL genes of African swine fever strains_ Nucleotide positions refer to the ASFV Georgia 2007/1 genome sequence (GenBank accession number FR682468_1)_ PAM sequences are marked in bold
Name | Sequence | Position | Length |
---|---|---|---|
A238L-1 | 50.832–50.851 | 20 | |
A238L-2 | TCGCATCTATTGACAATCCA | 51.027–51.046 | 20 |
EP402R-1 | 73.627–73.646 | 20 | |
EP402R-2 | 73.705–73.724 | 20 | |
9GL-1 | 95.099–95.117 | 19 | |
9GL-2 | 95.285–95.304 | 20 |
Primers used for amplification of the region of interest covering target genes_ Nucleotide positions refer to the ASFV Georgia 2007/1 genome sequence (GenBank accession number: FR682468_1)
Name | Sequence | Position | Tm (Primer melting temperature) |
---|---|---|---|
A238L-F | TTGGACACAGGAAACGATCT | 50.370–50.389 | 49.7°C |
A238L-R | ATATGGGAAAAGGGCCTGGC | 51.302–51.283 | 53.8°C |
EP402R-F | ACTATATTATAAAACATATG | 73.341–73.360 | 37.4°C° |
EP402R-R | TGCATGTGATGGAAATCGGT | 74.594–74.575 | 49.7°C |
9GL-F | GCCTCACTATCGATCGGCAA | 94.046–94.065 | 53.8°C |
9GL-R | ACTGGCTGGAATTACGCCAA | 95.450–95.431 | 51.8°C |
A224L-F | AAAAGCTATTTGTTTATCCCCA | 46.266–46.287 | 47.4°C |
A224L-R | CCTTCAATTGAGGATGATCATT | 47.057–47.036 | 49.2°C |
Results obtained in real-time PCR
Target site | PPAM Puromycin 24 h | PPAM Puromycin 48 h | PBM Puromycin 24 h | PBM Puromycin 48 h | ||||
---|---|---|---|---|---|---|---|---|
I | II | I | II | I | II | I | II | |
9GL-1 | 33.89 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 33.85 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 34.14 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 35.97 | 31.95 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | - | 31.48 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 38.62 |
9GL-2 | 34.49 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 31.05 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 34.38 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 31.99 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 31.65 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 33.55 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 32.37 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 34.08 |
A238L-1 | 32.26 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 31.3 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 32.75 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 31.26 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 32.34 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 28.5 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 32.88 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | - |
A238L-2 | 32.92 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 31.93 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 32.92 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 29.88 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 31.93 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 30.52 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 33.61 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 35.54 |
EP402R-1 | 31.92 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 38.71 | 33 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 29.76 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 32.74 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 34.21 | 32.9 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 33.79 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin |
EP402R-2 | 31.79 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 28.82 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 32.8 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 36.25 | 32.89 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 38.69 | 32.59 haemadsorption; I (II) – first (second) passage after 24 (48) h of incubation with puromycin | 34.81 |