<abstract xmlns="http://www.w3.org/1999/xhtml">

<p>Specimens of <italic>Tripylina zhejiangensis,</italic> collected from natural grass in the Free State Province of South Africa, were identified morphologically and molecularly. This species characterizes by body length (1037 – 1128 μm), a = 27.3 – 35.3, b = 5.1 – 5.6, c = 16.1 – 19.8, c’ = 2.5 – 3.4, V = 62 – 65. Molecular analysis was also undertaken, based on the 28S rDNA regions, and confirmed this population as <italic>T. zhejiangensis</italic>. Phylogenetic analysis using the Bayesian inference method, places this population in a clade close to <italic>T. zhejiangensis</italic> with a 1.00 posterior probability value. According to the knowledge, this is the first report of the genus <italic>Tripylina</italic> and its species from South Africa. Besides, this is the second report of <italic>T</italic>. <italic>zhejiangensis</italic> worldwide after the original description from China.</p></abstract>

Specimens of Tripylina zhejiangensis, collected from natural grass in the Free State Province of South Africa, were identified morphologically and molecularly. This species characterizes by body length (1037 – 1128 μm), a = 27.3 – 35.3, b = 5.1 – 5.6, c = 16.1 – 19.8, c’ = 2.5 – 3.4, V = 62 – 65. Molecular analysis was also undertaken, based on the 28S rDNA regions, and confirmed this population as T. zhejiangensis. Phylogenetic analysis using the Bayesian inference method, places this population in a clade close to T. zhejiangensis with a 1.00 posterior probability value. According to the knowledge, this is the first report of the genus Tripylina and its species from South Africa. Besides, this is the second report of T. zhejiangensis worldwide after the original description from China.


<div xmlns="http://www.w3.org/1999/xhtml">
<sec id="j_helm-2022-0025_s_001"><div>Introduction</div>
<p>The genus <italic>Tripylina</italic> established by <a ref-type="bibr" href="#j_helm-2022-0025_ref_004">Brzeski, 1963</a> and it is represented by free-living, predacious species that inhabit soil, litter, moss, and other semi-wet biotopes (<a ref-type="bibr" href="#j_helm-2022-0025_ref_002">Andrássy, 2007</a>; <a ref-type="bibr" href="#j_helm-2022-0025_ref_021">Zhao, 2009</a>; <a ref-type="bibr" href="#j_helm-2022-0025_ref_019">Xu et al., 2013</a>). This genus currently includes 22 valid species described from different regions of the world (<a ref-type="bibr" href="#j_helm-2022-0025_ref_014">Renčo et al., 2021</a>). Besides, this genus members have been studied from all continents (<a ref-type="bibr" href="#j_helm-2022-0025_ref_020">Yeates, 1972</a>; <a ref-type="bibr" href="#j_helm-2022-0025_ref_018">Tsalolikhin, 1983</a>; Brzeski &amp; Winiszewska-Ślipińska, 1993; <a ref-type="bibr" href="#j_helm-2022-0025_ref_001">Andrássy, 2008</a>; <a ref-type="bibr" href="#j_helm-2022-0025_ref_021">Zhao, 2009</a>; <a ref-type="bibr" href="#j_helm-2022-0025_ref_007">Cid del Prado-Vera et al., 2010</a>; Tahseen &amp; Nusrat, 2010; Cid del Prado-Vera et al., 2012, 2016; <a ref-type="bibr" href="#j_helm-2022-0025_ref_014">Renčo et al., 2021</a>). <italic>Tripylina</italic> spp. are characterized by having six long and four short cephalic setae in a single whorl, a prodelphic and reflexed gonad without a post-vulval sac, and curved tails in both sexes (<a ref-type="bibr" href="#j_helm-2022-0025_ref_022">Zullini, 2006</a>). Despite some species such as <italic>T. bravoe</italic> Cid del Prado-Vera, Ferris, Nadler and Lamothe-Argumedo, 2012; <italic>T. iandrassyi</italic> Cid del Prado-Vera, Ferris and Nadler, 2016, <italic>T. longa</italic> <a ref-type="bibr" href="#j_helm-2022-0025_ref_005">Brzeski and Winiszewska-Ślipińska, 1993</a> and re-described materials of an original description of <italic>T. gorganensis</italic> Asghari, Pourjam, Heydari, Zhao and Ramaji, 2012 studied by <a ref-type="bibr" href="#j_helm-2022-0025_ref_014">Renčo et al. (2021)</a> have a post-vulval sac (<a ref-type="bibr" href="#j_helm-2022-0025_ref_008">Cid del Prado-Vera et al., 2016</a>). <italic>Tripylina</italic> members were divided into two groups based on the position of the sub ventral teeth by <a ref-type="bibr" href="#j_helm-2022-0025_ref_021">Zhao (2009)</a>. Despite various research done on free-living nematodes, <italic>Tripylina</italic> species have not been reported yet from South Africa. <italic>Tripylina zhejiangensis</italic> Pham, Wang, Zhao and Zheng, 2013 has been described from China. Therefore, the aims of the present work were 1) to study the morphology of <italic>T. zhejiangensis</italic>, and 2) to study the molecular characters of <italic>T. zhejiangensis</italic> using 28S rDNA markers.</p>
</sec>
<sec id="j_helm-2022-0025_s_002"><div>Materials and Methods</div>
<sec id="j_helm-2022-0025_s_002_s_001"><div>Nematode extraction, processing, and LM pictures</div>
<p>Specimens were collected at Parys, Free State Province, close to the river in association with the natural grass (S 26° 54’ 37.336”, E 27°27’ 24.582”). The specimens were extracted using the tray method and were fixed with a hot 4 % formaldehyde solution and transferred to anhydrous glycerin using the <a ref-type="bibr" href="#j_helm-2022-0025_ref_010">De Grisse (1969)</a> method. The nematodes were processed and studied at Aquacultutre Research Unit, University of Limpopo. The classification provided by <a ref-type="bibr" href="#j_helm-2022-0025_ref_021">Zhao (2009)</a> was used for the taxonomical study of <italic>Tripylina</italic> spp. Pictures were taken with a Nikon Eclipse 80i light microscope equipped with a digital camera (Nikon, Tokyo, Japan). The LM taken was used for the line illustration. The line illustration was edited using Adobe® Photoshop® CS.</p>
</sec>
<sec id="j_helm-2022-0025_s_002_s_002"><div>DNA extraction, PCR, and phylogenetic analysis</div>
<p>DNA extraction was done using the Chelex method (Straube &amp; Juen, 2013). Five specimens of the species were hand-picked with a fine tip needle and transferred to a 1.5 ml Eppendorf tube containing 20 μl double distilled water. The nematodes in the tube were crushed with the tip of a fine needle and vortexed. Thirty microliters of 5 % Chelex® 50 and 2 μL of proteinase K was added to the microcentrifuge tube that contained the crushed nematodes and mixed. The microcentrifuge tube with the nematode lysate was incubated at 56 °C for two hours and then incubated at 95 °C for 10 minutes to deactivate the proteinase K and finally spun for 2 min at 16000 rpm (<a ref-type="bibr" href="#j_helm-2022-0025_ref_016">Shokoohi, 2021</a>). The supernatant was then extracted from the tube and stored at –20 °C. Following this step, the forward and reverse primers, D2A (5’–ACAAGTACCGTGAGGGAAAGTTG–3’), D3B (5’–TCGGAAGGAACCAGCTACTA–3’) (De Ley et al., 1999), were used in the PCR reactions for partial amplification of the D2/D3 region of 28S. PCR was conducted with 8 μl of the DNA template, 12.5 μl of 2X PCR Master Mix Red (Promega, USA), 1 μl of each primer (10 pmol μl<sup>-1</sup>), and ddH<sub>2</sub>O for a final volume of 30 μl. The amplification was processed using an Eppendorf master cycler gradient (Eppendorf, Hamburg, Germany), with the following program: initial denaturation for 3 min at 94 °C, 37 cycles of denaturation for 45 s at 94 °C; 56 °C annealing temperature for 45 s and 72 °C for 1 min, and finally an extension step of 6 min at 72 °C followed by a temperature on hold at 4 °C. After DNA amplification, 4 μl of PCR product was loaded on a 1 % agarose gel in TBE buffer (40 mM Tris, 40 mM boric acid, and one mM EDTA) for evaluation of the DNA bands. The band was stained with RedGel and visualized and photographed on a UV transilluminator. The PCR product was stored at –20 °C. Finally, Inqaba Biotech (South Africa) purified the PCR product for sequencing.</p>
<p>The ribosomal DNA sequences were analyzed and edited with BioEdit (<a ref-type="bibr" href="#j_helm-2022-0025_ref_012">Hall, 1999</a>) and aligned using CLUSTAL W (Thompson et al., 1994). Phylogenetic tree was generated using the Bayesian inference method as implemented in the program Mr Bayes 3.1.2 (Ronquist &amp; Huelsenbeck, 2003). The GTR+I+Γ model was selected using jModeltest 2.1.10 (Guindon &amp; Gascuel, 2003; <a ref-type="bibr" href="#j_helm-2022-0025_ref_009">Darriba et al., 2012</a>). Analysis was initiated with a random starting tree and ran with the Markov chain Monte Carlo (MCMC) for 10<sup>6</sup> generations for 28S rDNA. The tree was visualized with the TreeView program. Also, as outgroups, <italic>Dorylaimus stagnalis</italic> (MF125467, MF125468) were selected based on <a ref-type="bibr" href="#j_helm-2022-0025_ref_013">Pham et al. (2013)</a>. The original partial 28S rDNA sequence of <italic>T. zhejiangensis</italic> was deposited in GenBank under the accession number OM891776.</p>
</sec></sec>
<sec id="j_helm-2022-0025_s_003"><div>Ethical Approval and/or Informed Consent</div>
<p>The author confirms that the ethical policies of the journal, as noted on the journal’s author guidelines page, have been adhered. The author confirms that the conducted research is neither related to human nor animal use.</p>
</sec>
<sec id="j_helm-2022-0025_s_004"><div>Results</div>
<sec id="j_helm-2022-0025_s_004_s_001"><div><italic>Tripylina zhejiangensis</italic> Pham, Wang, Zhao &amp; Zheng, 2013</div>
<p>Morphological characterization (ten females in a good state of preservation)</p>
<p><a ref-type="fig" href="#j_helm-2022-0025_fig_001">Fig. 1</a>; <a ref-type="table" href="#j_helm-2022-0025_tab_001">Table 1</a></p>
<figure id="j_helm-2022-0025_fig_001" position="float" fig-type="figure">
<h2>Fig. 1</h2>
<figCaption><p><italic>Tripylina zhejiangensis</italic> Pham, Wang, Zhao and Zheng, 2013. (A) anterior end; (B) lip region; (C) entire body; (D) pharyngeal-intestinal junction; (E) female posterior end; (F) female reproductive system.</p></figCaption>
<img xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="graphic/j_helm-2022-0025_fig_001.jpg" src="https://sciendo-parsed.s3.eu-central-1.amazonaws.com/6471e94e215d2f6c89db4c06/j_helm-2022-0025_fig_001.jpg?X-Amz-Algorithm=AWS4-HMAC-SHA256&amp;X-Amz-Date=20240602T020326Z&amp;X-Amz-SignedHeaders=host&amp;X-Amz-Expires=18000&amp;X-Amz-Credential=AKIA6AP2G7AKP25APDM2%2F20240602%2Feu-central-1%2Fs3%2Faws4_request&amp;X-Amz-Signature=576b4016cccfa610d0bafb8047a7c7f158d66bac5fd2372326579ad2c6982f84" class="mw-100"/>
</figure>
<table-wrap id="j_helm-2022-0025_tab_001" position="float">
<label>Table 1</label>
<caption><p>Measurements of females of <italic>Tripylina zhejiangensis</italic> from South Africa. All measurements are in μm and in the form: mean ± SD (range), except for the ratio.</p></caption>
<table frame="hsides" rules="groups">
<thead><tr><th align="center">Character</th>
<th align="center">Present study South Africa</th>
<th align="center"><a ref-type="bibr" href="#j_helm-2022-0025_ref_013">Pham et al., 2013</a> China</th>
</tr>
<tr><th align="center">n</th>
<th align="center">10 females</th>
<th align="center">23 females</th>
</tr></thead>
<tbody>
<tr><td align="center">L</td>
<td align="center">1075.0 ± 36.5 (1037 – 1128)</td>
<td align="center">1152 – 1631</td>
</tr>
<tr><td align="center">a</td>
<td align="center">31.0 ± 3.3 (27.3 – 35.5)</td>
<td align="center">23.3 – 36.4</td>
</tr>
<tr><td align="center">b</td>
<td align="center">5.4 ± 0.2 (5.1 – 5.6)</td>
<td align="center">5.0 – 6.6</td>
</tr>
<tr><td align="center">c</td>
<td align="center">18.2 ± 1.8 (16.1 – 19.8)</td>
<td align="center">13.4 – 19.7</td>
</tr>
<tr><td align="center">c'</td>
<td align="center">3.0 ± 0.4 (2.5 – 3.4)</td>
<td align="center">2.6 – 3.6</td>
</tr>
<tr><td align="center">V</td>
<td align="center">64.0 ± 1.2 (62 – 65)</td>
<td align="center">60 – 70</td>
</tr>
<tr><td align="center">Lip region width</td>
<td align="center">17.6 ± 1.0 (16 – 19)</td>
<td align="center">19 – 30</td>
</tr>
<tr><td align="center">Labial setae</td>
<td align="center">11.4 ± 1.7 (10 – 15)</td>
<td align="center">11 – 16</td>
</tr>
<tr><td align="center">Dorsal tooth from the anterior end</td>
<td align="center">14.5 ± 3.2 (10 – 20)</td>
<td align="center">11 – 21</td>
</tr>
<tr><td align="center">Amphid position from the anterior end</td>
<td align="center">13.5 ± 0.7 (13 – 14)</td>
<td align="center">12 – 17</td>
</tr>
<tr><td align="center">Nerve ring from the anterior end</td>
<td align="center">87.6 ± 2.1 (85 – 90)</td>
<td align="center">99 – 139</td>
</tr>
<tr><td align="center">Pharynx</td>
<td align="center">170.1 ± 10.5 (155 – 186)</td>
<td align="center">163 – 164*</td>
</tr>
<tr><td align="center">Neck length</td>
<td align="center">198.7 ± 6.1 (187 – 204)</td>
<td align="center">183 – 186*</td>
</tr>
<tr><td align="center">Cardia length</td>
<td align="center">20.6 ± 3.1 (18 – 26)</td>
<td align="center">20 – 27</td>
</tr>
<tr><td align="center">Cardia diameter</td>
<td align="center">7.3 ± 2.1 (5 – 9)</td>
<td align="center">8.5 – 14</td>
</tr>
<tr><td align="center">Body diameter at neck base</td>
<td align="center">30.8 ± 4.0 (25 – 37)</td>
<td align="center">34 – 36*</td>
</tr>
<tr><td align="center">Body diameter at mid-body</td>
<td align="center">33.7 ± 2.8 (25 – 38)</td>
<td align="center">43*</td>
</tr>
<tr><td align="center">Body diameter at anus</td>
<td align="center">21.0 ± 2.4 (17 – 24)</td>
<td align="center">23 – 29*</td>
</tr>
<tr><td align="center">Tail length</td>
<td align="center">61.2 ± 8.6 (53 – 72)</td>
<td align="center">73 – 103</td>
</tr>
<tr><td align="center">Anterior end to vulva</td>
<td align="center">696.4 ± 49.5 (653 – 776)</td>
<td align="center">757 – 1045</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn-group>
<fn><p>* = extracted from original drawing</p></fn>
</fn-group>
</table-wrap-foot>
</table-wrap>
</sec></sec>
<sec id="j_helm-2022-0025_s_005"><div>Description</div>
<p><bold>Female</bold>: Body ventrally arcuate after heat relaxation, moderately large, robust, posterior region more curved than anterior. Cuticle smooth, not striated, with numerous body pores along entire body. Six long (10 – 15 μm) and four short cephalic setae (5 – 7 μm) in a single whorl. Lip region rounded, continuous with body contour, 16 – 19 μm width. Lip region dome-shaped, with three triangular lips, inner labial papillae conical, outer labial setae. Thick stomatal walls, with a large triangular dorsal tooth in a stomatal chamber, pointing towards ventral side. Stoma 18 – 30 μm long, 1 – 3 μm width. Two triangular subventral teeth located posterior to dorsal tooth (<a ref-type="fig" href="#j_helm-2022-0025_fig_001">Fig 1B).</a> Tooth length 1 – 2 μm, tooth width 0.5 – 0.8 μm. Amphids cup-like, located at 13 – 14 μm from anterior end. Amphidal aperture diameter 2.8 – 3.3 μm. Excretory pore not observed. Nerve ring 85 – 90 μm or 43 – 47 % of neck length from anterior end of body. A prominent cardia separates the pharynx and intestine, 18 – 26 μm long and 5-9 μm wide. Pharyngo-intestinal valve composed of three glands around anterior portion of intestine. An ingested nematode was observed within the intestine of one specimen of this species. Female genital system mono-prodelphic without post-vulval sac. Vulva simple, lacking protuberant lips, vagina 5 – 9 μm long. Vulva-anus distance 278 – 319 μm. Rectum 16 – 23 μm long. Tail bent ventrad, a pair of subdorsal caudal setae on anterior part of tail, three tandem caudal glands, a terminal spinneret, 3 – 4 μm long.</p>
</sec>
<sec id="j_helm-2022-0025_s_006"><div><bold>Male</bold>: not found</div>
<p><bold>Remarks</bold>: The South African population of <italic>T. zhejiangensis</italic> resembles the original description studied in China (<a ref-type="bibr" href="#j_helm-2022-0025_ref_013">Pham et al., 2013</a>). However, compared with the Chinese population, they differ in body length (1037 – 1128 vs 1152 – 1631 μm), amphid from anterior end (13 – 17 vs 12 – 17 μm), and tail length (53 – 72 vs 73 – 103 μm).</p>
</sec>
<sec id="j_helm-2022-0025_s_007"><div>Discussion</div>
<p>The forward D2 and reverse D3 primers of 28S rDNA for <italic>T. zhejiangensis</italic> isolated 722 base pairs long. The nBlast test of 28S rDNA showed 99 % similarity of the test population with the Chinese population of <italic>T. zhejiangensis</italic> (KC008577) with only one base pair difference. Compared with the Iranian sequences of <italic>T. zhejiangensis</italic> (KY115144; KY115147), it showed 99 % similarity with one and three base pairs differences, respectively.</p>
<p>Our phylogenetic analysis using 28S rDNA, placed the South African <italic>T. zhejiangensis</italic> population in a clade together with other <italic>T. zhejiangensis</italic> populations with 1.00 posterior probability values (<a ref-type="fig" href="#j_helm-2022-0025_fig_002">Fig. 2</a>). Findings in the current study were in agreement with the phylogenies of <italic>Tripylina</italic> species studied (<a ref-type="bibr" href="#j_helm-2022-0025_ref_021">Zhao, 2009</a>; <a ref-type="bibr" href="#j_helm-2022-0025_ref_013">Pham et al., 2013</a>; <a ref-type="bibr" href="#j_helm-2022-0025_ref_014">Renčo et al., 2021</a>). Two permanent microscope slides containing the females of <italic>T. zhejiangensis</italic> were deposited in the Aquaculture Research Unit of the University of Limpopo, South Africa. According to the literature, this is the first record of <italic>T. zhejiangensis</italic> in South Africa. In conclusion, the morphometrical variation that exists between the <italic>T. zhejiangensis</italic> (e.g., vulva position, tail length, body length) is due to the geographical location of the population.</p>
<figure id="j_helm-2022-0025_fig_002" position="float" fig-type="figure">
<h2>Fig. 2</h2>
<figCaption><p>28S rDNA Bayesian tree inferred from known and newly sequenced <italic>Tripylina zhejiangensis</italic> from South Africa.</p></figCaption>
<img xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="graphic/j_helm-2022-0025_fig_002.jpg" src="https://sciendo-parsed.s3.eu-central-1.amazonaws.com/6471e94e215d2f6c89db4c06/j_helm-2022-0025_fig_002.jpg?X-Amz-Algorithm=AWS4-HMAC-SHA256&amp;X-Amz-Date=20240602T020326Z&amp;X-Amz-SignedHeaders=host&amp;X-Amz-Expires=18000&amp;X-Amz-Credential=AKIA6AP2G7AKP25APDM2%2F20240602%2Feu-central-1%2Fs3%2Faws4_request&amp;X-Amz-Signature=672c441f09d070dfc6ed677022ecb661f372892d09529f9d4d43f49d33aedbe3" class="mw-100"/>
</figure>
</sec>
</div>

First report of <italic>Tripylina zhejiangensis</italic> associated with grassland in South Africa

Helminthologia

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

First report of  associated with grassland in South Africa

Specimens of Tripylina zhejiangensis, collected from natural grass in the Free State Province of South Africa, were identified morphologically and molecularly....

First report of Tripylina zhejiangensis associated with grassland in South Africa

Article Category: Research Article

Data publikacji: 17 gru 2022

Zakres stron: 311 - 316

Otrzymano: 05 mar 2022

Przyjęty: 09 sie 2022

DOI: https://doi.org/10.2478/helm-2022-0025

Słowa kluczowe
South Africa, grass, morphology, rDNA, phylogeny

© 2022 E. Shokoohi, published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

First report of Tripylina zhejiangensis associated with grassland in South Africa

Article Category: Research Article

Data publikacji: 17 gru 2022

Zakres stron: 311 - 316

Otrzymano: 05 mar 2022

Przyjęty: 09 sie 2022

DOI: https://doi.org/10.2478/helm-2022-0025

Słowa kluczoweSouth Africa, grass, morphology, rDNA, phylogeny

© 2022 E. Shokoohi, published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Słowa kluczowe
South Africa, grass, morphology, rDNA, phylogeny