European beech (
This paper presents the results of nuclear-microsatellite analyses of beech populations from ten regions in the Czech Republic. To evaluate their population genetics parameters, we used two newly modified multiplexes (13- and 8-plex). We focused on the following questions: (i) Are there significant differences between local beech populations across the Czech Republic? (ii) Can we eventually identify substantial differences among the targeted population? (iii) What is the discrimination power of our marker assemblage?
We identified ten beech stands across the Czech Republic (Table 1, Figure 3) aiming at populations that are considered to be locally adapted and superior under local conditions. Each of the selected populations was represented either by 20 or 30 mature individuals according to the site characteristics, which turned into 250 tested individuals in total. Sampling was carried out in 2017. The minimal distance between sampled trees was 30 m to avoid sampling among closely related individuals (von Wühlisch, 2008). For each individual, we collected unburst buds and extracted the vascular cambium with a hole punch. Plant tissues were labeled appropriately and placed in plastic bags with silica gel. Then they were long-term stored in a freezer.
Stand-specific data of the samples.
No. of Population | Provenance Name | Average Altitude (m a.s.l.) | Geographic Coordinates | No. of Samples | |
---|---|---|---|---|---|
latitude | longitude | ||||
1 | Frýdlant | 441 | 50°52′24.1″N | 15°06′36.1″E | 20 |
2 | Kladská | 755 | 50°00′11.8″N | 12°38′55.5″E | 20 |
3 | Litvínov | 794 | 50°36′46.8″N | 13°23′14.5″E | 20 |
4 | Boubín | 916 | 49°09′05.5″N | 13°40′03.2″E | 20 |
5 | Nové Hrady | 863 | 48°39′46.6″N | 14°40′51.0″E | 20 |
6 | Hluboká | 538 | 49°06′24.3″N | 14°29′51.6″E | 30 |
7 | Jeseník | 652 | 50°11′34.1″N | 17°13′55.0″E | 30 |
8 | Frýdek Místek | 839 | 49°31′44.7″N | 18°28′28.6″E | 30 |
9 | Luhačovice | 479 | 49°03′06.0″N | 18°04′19.0″E | 30 |
10 | Lanškroun | 573 | 49°56′07.4″N | 16°30′33.2″E | 30 |
Initially, both the vascular cambium and leaf buds were tested for DNA extraction. Even though both types of tissues provided identical genetic profiles, we decided to extract the DNA from the buds, because of its higher purity and yield. From each individual, approximately 2 or 3 unsterilized fresh buds were cut into small pieces and placed into 2 mL safe-lock tubes (Eppendorf, Germany). Two 3 mm tungsten beads were added in each tube and frozen in liquid nitrogen before grinding (1 min, 30 Hz) using a mixer mill MM400 (Retsch, Haan, Germany). Genomic DNA was extracted with the Geneaid® Genomic DNA Mini Kit (Plant) according to the manufacturer's instructions with a minor modification in the lysis step (60 min of incubation phase). The DNA quantity and quality were measured with a NanoDrop® 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The quality of the DNA was verified using 1.5% agarose gel electrophoresis. For subsequent Polymerase Chain Reaction (PCR) steps, we diluted all DNA samples to a working concentration of 20 ng/μL.
After amplification in single reactions, from preselected microsatellite loci, we excluded those which were difficult to evaluate or of low polymorphism (< 4 alleles), with poor amplification quality or low signal intensity. This led to a total number of 21 highly validated fluorescently labeled genomic markers – mfc5, mfc7 a mfc11 (Tanaka
Features of microsatellite primers assembled into multiplexes (SSR: simple sequence repeats).
SSR Locus | Allele Size Range (bp)* | Primer Sequences 5′ –3′ | Repeats | Fluorescent Dye | Source Reference | Primers Volume F + R [μL]** | ||
---|---|---|---|---|---|---|---|---|
F | R | |||||||
Multiplex 1 | concat14_A_0 | 170–197 | TGAAGAAATTCACAACCCAACA | GGGTTGTTTACGATGGTGGA | (TC)9 | PET | 1 | 0.6 |
EMILY_A_0 | 142–152 | GACCCCAAGGTTACAGTGCT | CGTACAATTGCACCCACATC | (GA)11 | PET | 1 | 0.36 | |
csolfagus_31 | 103–130 | TCTATTGACACAAGAATAAGAACACC | CTTGGCAAGAAAAGGGGATT | (AG)12 | PET | 1 | 0.45 | |
mfc11 | 310–360 | ACAGATAAAAACAGAAGCCA | TTTGGTTTTGTTGAGTTTAG | (AG)10 | NED | 2 | 0.45 | |
DE576_A_0 | 210–240 | TCTCCTTAGATCCACAATCACA | AGCTCTTCATTGCTCAGAACG | (CAA)10 | NED | 1 | 0.9 | |
csolfagus_05 | 167–180 | GGTTTCTAGCAAAATTGGCATT | CCCAAAAGGCCCTACTACAA | (GA)10 | NED | 1 | 0.36 | |
FS1-03 | 90–140 | CACAGCTTGACACATTCCAAC | TGGTAAAGCACTTTTTCCCACT | (GA)18 | NED | 3 | 0.24 | |
mfc5 | 270–340 | ACTGGGACAAAAAAACAAAA | GAAGGACCAAGGCACATAAA | (AG)10 | FAM | 2 | 0.6 | |
csolfagus_19 | 150–185 | TGCCCATGAGGTTTGTATCA | GCCGAATAACCCAGAAAACA | (TC)13 | FAM | 1 | 0.24 | |
csolfagus_06 | 200–225 | GTTGTTGCTCACAGCAGTCG | ACGCTTGGTCTTCTTGCACT | (AG)13 | FAM | 1 | 0.24 | |
sfc0036 | 90–140 | CATGCTTGACTGACTGTAAGTTC | TCCAGGCCTAAAAACATTTATAG | (TC)23 | FAM | 4 | 0.3 | |
mfc7 | 110–104 | AAAATACACTGCCCCCAAAA | CAGGTTTTGGTTTCTTACAC | (GA)9 | VIC | 2 | 0.3 | |
ERHBI_A_0 | 159–167 | TGCAACAACTTAGCACTTTGA | GCGTGTGGCTTATCCAAAAT | (AG)9 | VIC | 1 | 0.12 | |
Multiplex 2 | EEU75_A_0 | 90–115 | TTCCAAACCAACCCTTTATCC | GACGGAGATTGAGGAAGAACA | (CT)10 | PET | 1 | 0.3 |
Fagsyl_002929 | 152–210 | GCGGCGACTGGAATAATAGC | CAATCACACGCTGCACAAAC | (TTG)x | NED | 5 | 0.3 | |
Fagsyl_003849 | 98–128 | GCTTCGTTCTTCGGCATCTC | AATAGCACAAATAGCCCGCC | (CT)x | NED | 5 | 0.21 | |
DZ447_A_0 | 186–194 | GGTGCAATACTTCACTTTAGGACA | ATAGGAGTGGGACGGCTAGG | (TC)10 | FAM | 1 | 0.3 | |
csolfagus_29 | 130–150 | CACAACCTGCATTCCCTTTC | GTTTGGCACTTTGGCTTGTT | (CT)11 | FAM | 1 | 0.18 | |
Fagsyl_001018 | 107–130 | AATATCAGGGAGGCAGCACC | CGAGATGGACTTCTAAGTTTTATTTGC | (CA)x | FAM | 5 | 0.21 | |
DUKCT_A_0 | 75–95 | GCCTCTCGCAGCTCCTATAA | GATCTAATGTGGGTTTGGTTTTG | (AC)14 | FAM | 1 | 0.18 | |
Fagsyl_003093 | 150–205 | TCATCACCGAGACAAGGGAC | ATGGTGGTGTGGAAGCTAGG | (CA)x | VIC | 5 | 0.18 |
Allele Size Range stands for minimum and maximum lengths of PCR products detected for a locus (in base pairs).
Final concentration in each primer premix forward + reverse.
Amplification was performed in two multiplex polymerase chain reactions (Mastercycler® nexus, Eppendorf, Germany). The PCR mixture for multiplex 1 was performed in a total volume of 11.4 μL containing 1 μL template DNA (c = 20 ng/μL), 5.7 μL of Type-it® solution (Qiagen, Hilden, Germany), 0.26 μL sterile water and a total volume of 4.44 μL primer premix. The PCR for multiplex 2 was performed in a total volume of 6 μL, consisting of 1 μL template DNA (c = 20 ng/μL), 3 μL of Type-it® solution (Qiagen, Hilden, Germany), 0.14 μL of sterile water and 1.86 μL of primer premix. Concentrations and label dyes for each primer pair in the final primer premix are shown in Table 2. Both multiplexes had the same PCR conditions as follows: an initial incubation (5 min at 95 °C) was followed by 33 cycles consisting of the denaturation (45 s at 95 °C), annealing (45 s at 60 °C) and extension phase (60 s at 72 °C). Amplification was terminated with the final extension step (30 min at 72 °C). The fluorescently labelled PCR products, together with an internal size standard (GMC-GT500 LIZ) were processed on a 3500 Series Genetic Analyzer® (Applied Biosystems, Foster City, CA, USA).
Allele identification and genotyping were done using the GeneMarker® Fragment Analysis software (SoftGenetics, State College, PA, USA). All alleles were subsequently checked manually to minimize genotyping errors. Allele frequency analysis was performed using CERVUS v. 3.0.7 (Kalinowski
For the analysis of population genetic parameters, we used software GenAIEx v. 6.5 (Peakall & Smouse, 2006, 2012). To group populations according to their pairwise distances in a distance matrix, a Principal Coordinate Analysis (PCoA) was carried out. The distribution of total variance at different hierarchical levels was quantified with an Analysis of Molecular Variance (AMOVA). We also evaluated the discrimination power of assembled multiplexes. Therefore, the Probability of Identity (
All samples (n = 250) were genotyped on 21 SSR loci grouped into two multiplexes (Table 3). The number of genotyped individuals on each locus (
Locus-specific parameters.
Locus | |||||||
---|---|---|---|---|---|---|---|
concat14_A_0 | 4 | 249 | 0.474 | 0.494 | 0.461 | NS | 0.0229 |
EMILY_A_0 | 6 | 249 | 0.763 | 0.770 | 0.731 | NS | 0.0009 |
csolfagus_31 | 13 | 249 | 0.855 | 0.858 | 0.842 | NS | −0.0005 |
mfc11 | 9 | 249 | 0.353 | 0.616 | 0.594 | *** | |
DE576_A_0 | 7 | 248 | 0.710 | 0.669 | 0.613 | NS | −0.0325 |
csolfagus_05 | 8 | 249 | 0.675 | 0.679 | 0.639 | NS | 0.0068 |
FS1-03 | 14 | 246 | 0.528 | 0.622 | 0.594 | ** | |
mfc5 | 22 | 249 | 0.669 | 0.906 | 0.897 | ** | |
csolfagus_19 | 13 | 249 | 0.803 | 0.844 | 0.824 | NS | 0.0262 |
csolfagus_06 | 12 | 248 | 0.859 | 0.867 | 0.851 | NS | 0.0042 |
sfc0036 | 8 | 248 | 0.786 | 0.772 | 0.744 | NS | −0.0114 |
mfc7 | 9 | 249 | 0.578 | 0.596 | 0.559 | NS | |
ERHBI_A_0 | 6 | 249 | 0.514 | 0.530 | 0.491 | NS | 0.0163 |
EEU75_A_0 | 11 | 245 | 0.808 | 0.805 | 0.777 | NS | −0.0040 |
Fagsyl_002929 | 11 | 247 | 0.765 | 0.729 | 0.693 | NS | −0.0269 |
Fagsyl_003849 | 14 | 247 | 0.814 | 0.808 | 0.783 | NS | −0.0034 |
DZ447_A_0 | 4 | 245 | 0.592 | 0.593 | 0.545 | NS | 0.0051 |
csolfagus_29 | 8 | 248 | 0.435 | 0.436 | 0.400 | NS | −0.001 |
Fagsyl_001018 | 9 | 246 | 0.390 | 0.656 | 0.608 | *** | |
DUKCT_A_0 | 8 | 246 | 0.537 | 0.569 | 0.449 | NS | 0.0291 |
Fagsyl_003093 | 12 | 194 | 0.216 | 0.571 | 0.530 | *** | |
Mean | 9.905 | 245 | 0.625 | 0.685 | 0.649 | ||
SD | 4.098 | 0.183 | 0.134 | 0.146 | |||
SE | 0.894 | 0.040 | 0.029 | 0.032 |
Number of allele per locus (
NS – not significant), estimation of null allele frequency (
The total amount of 208 alleles was detected. The number of alleles per locus (
Private alleles were found in all analyzed populations except populations 5 and 10. The frequencies of rare alleles were generally low and ranged between 0.017 and 0.077, with an average of 0.033 ± 0.019. The highest amount of private alleles was observed in populations 1 and 9. Private alleles with the highest frequencies were found in population 2.
In order to evaluate the discriminatory power of used multiplexes, the Probability of Identity (
The discriminatory power of loci expressed by Probability of Identity (PI) for unrelated individuals (orange line) and related individuals (green line).
In our study, we also evaluated a modified version
The parameter of observed heterozygosity (
The Principal Coordinate Analysis was performed based on genetic distances between the populations (e.g. the pairwise population matrix of Nei's genetic distance, Table 5). The result of PCoA is presented in Figure 2. The first two coordinates explain 35% of the total variation. PCoA sorted the populations in three groups, which can be simplified as south-west (Pops. 5, 4, 2, 3 and 7), north (Pops. 1 and 10), and southeast (Pops. 6, 9 and 8). Population 9 was the most distant from the others. The approximate regionalization of the populations is shown in Figure 3. However, in the scale of the Czech Republic, the geographical distance cannot be seen as the main driver of the genetic variation between the tested indigenous populations. AMOVA indicated that 98% of total molecular variance occurs within populations. Only 2%of the variation can be observed on an interpopulation level. It corresponds with the previous findings that a significant part of the genetic variability of forest trees is attributable to the intrapopulation level.
Principal Coordinate Analysis (PCoA) of the populations 1–10 (further described in Table 1).
Populations 1–10 divided into three regions by PCoA (populations further described in Table 1).
Estimations of population parameters.
Population | ||||||||
---|---|---|---|---|---|---|---|---|
1 | Mean | 19.524 | 6.905 | 3.925 | 1.447 | 0.635 | 0.674 | 0.074 |
0.290 | 0.581 | 0.522 | 0.102 | 0.046 | 0.030 | 0.042 | ||
2 | Mean | 19.571 | 6.476 | 3.583 | 1.414 | 0.629 | 0.662 | 0.072 |
0.335 | 0.550 | 0.339 | 0.093 | 0.057 | 0.034 | 0.063 | ||
3 | Mean | 19.381 | 6.238 | 3.427 | 1.363 | 0.595 | 0.650 | 0.089 |
0.288 | 0.530 | 0.335 | 0.095 | 0.047 | 0.033 | 0.054 | ||
4 | Mean | 19.667 | 6.571 | 3.627 | 1.410 | 0.623 | 0.667 | 0.069 |
0.159 | 0.500 | 0.364 | 0.091 | 0.049 | 0.032 | 0.054 | ||
5 | Mean | 19.810 | 6.667 | 3.625 | 1.416 | 0.632 | 0.664 | 0.045 |
0.190 | 0.618 | 0.383 | 0.095 | 0.048 | 0.032 | 0.054 | ||
6 | Mean | 29.381 | 6.905 | 3.549 | 1.393 | 0.607 | 0.651 | 0.082 |
0.288 | 0.589 | 0.417 | 0.098 | 0.044 | 0.032 | 0.042 | ||
7 | Mean | 29.857 | 7.238 | 3.792 | 1.439 | 0.623 | 0.667 | 0.064 |
0.143 | 0.617 | 0.419 | 0.104 | 0.044 | 0.035 | 0.046 | ||
8 | Mean | 29.667 | 7.381 | 3.879 | 1.484 | 0.630 | 0.678 | 0.064 |
0.333 | 0.674 | 0.502 | 0.099 | 0.039 | 0.030 | 0.046 | ||
9 | Mean | 29.190 | 6.905 | 3.501 | 1.415 | 0.654 | 0.670 | 0.041 |
0.190 | 0.625 | 0.290 | 0.088 | 0.043 | 0.028 | 0.038 | ||
10 | Mean | 29.143 | 6.905 | 3.648 | 1.419 | 0.619 | 0.662 | 0.062 |
0.469 | 0.625 | 0.419 | 0.098 | 0.042 | 0.032 | 0.046 | ||
Total | Mean | 24.519 | 6.819 | 3.655 | 1.420 | 0.625 | 0.664 | 0.066 |
0.352 | 0.185 | 0.126 | 0.030 | 0.014 | 0.010 | 0.015 |
Sample size (
Nei's genetic distances between the provenances (Nei, 1972, 1987)
1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | |
---|---|---|---|---|---|---|---|---|---|---|
0.000 | 1 | |||||||||
0.067 | 0.000 | 2 | ||||||||
0.071 | 0.078 | 0.000 | 3 | |||||||
0.064 | 0.061 | 0.069 | 0.000 | 4 | ||||||
0.078 | 0.061 | 0.064 | 0.049 | 0.000 | 5 | |||||
0.062 | 0.070 | 0.076 | 0.061 | 0.077 | 0.000 | 6 | ||||
0.064 | 0.059 | 0.053 | 0.051 | 0.062 | 0.067 | 0.000 | 7 | |||
0.082 | 0.062 | 0.064 | 0.062 | 0.067 | 0.056 | 0.049 | 0.000 | 8 | ||
0.079 | 0.075 | 0.088 | 0.081 | 0.091 | 0.056 | 0.074 | 0.057 | 0.000 | 9 | |
0.055 | 0.065 | 0.074 | 0.065 | 0.072 | 0.079 | 0.060 | 0.061 | 0.087 | 0.000 | 10 |
The mean value of observed heterozygosity (
The most variable locus was mfc5, as previous studies have shown (Vornam
The PCoA analysis clustered studied indigenous populations into three approximate regions, geographically roughly corresponding to north, south-east and southwest. However, on the scale of the Czech Republic, distance cannot be considered as a significant criterion of population clustering. Long-term local adaptive processes are more likely to cause it.
Significant differences in observed heterozygosity within populations have not been detected. In general, the genetic diversity of the investigated populations was similar to populations across Central Europe. In our study
AMOVA showed that 98% of total variability is observed on the intrapopulation level, only 2% occurs among the populations. This result is in agreement with previous studies as well, for example, Kempf & Konnert (2016) observed 93% of total variation within populations and 5% among them and 2% between observed regions. As previous findings suggest, little differentiation on interpopulation level might be due to an extensive gene flow between beech populations over long distances (Wang, 2004; Piotti
The results presented in this paper offer an insight into the genetic diversity of indigenous populations of European beech on the territory of the Czech Republic where only a few such studies have been done so far. Although the majority of detected variance is not attributable to a particular population, the evaluation of allelic parameters (heterozygosity, allelic diversity) is crucial and should not be omitted. Genetic variability, especially during artificial reforestation and the ongoing effort to increase the percentage of beech in the forests, should be carefully considered. It gains even more importance in the context of the continuing climate change, which is highly challenging for the adaptive and survival potential of species. In general, maximizing genetic diversity during artificial reforestation might prevent gene pool reduction and thus indirectly maintain allelic forms with higher fitness levels under shifted climatic conditions. Moreover, we confirmed that a well-optimized set of nuclear microsatellite markers is a useful and robust tool for the examination of genetic structure.