Otwarty dostęp

Targeted microRNA Profiling in Gastric Cancer with Clinical Assessement

, , , , ,  oraz   
05 cze 2022

Zacytuj
Pobierz okładkę

Figure 1

Expression changes of miRNAs in cancerous tissues.
Expression changes of miRNAs in cancerous tissues.

Figure 2

Relative expression changes of miRNAs in cancerous and normal tissues (*p <0,05, **p <0,01).
Relative expression changes of miRNAs in cancerous and normal tissues (*p <0,05, **p <0,01).

Figure 3

Hierarchical clustering and heatmap of miRNAs. Hierarchical cluster using “Euclidean” distance and “complete” linkage. (L.N.: Lymph node).
Hierarchical clustering and heatmap of miRNAs. Hierarchical cluster using “Euclidean” distance and “complete” linkage. (L.N.: Lymph node).

Comparison of patient age, metastatic lymph node number and smoking with miRNA expressions_

miRNA ID Age; r Value Age; p Value Metastatic Lymph Node; r Value Metastatic Lymph Node; p Value Smoking p Value
Hsa-miR-375-3p −0.160 0.512 0.350 0.135 0.102
Hsa-miR-148a-3p −0.320 0.196 0.290 0.240 0.245
Hsa-miR-196a-5p −0.330 0.159 0.430 0.056 0.412
Hsa-miR-376c-3p −0.420 0.063 0.410 0.075 0.043a
Hsa-miR-129-5p −0.320 0.173 0.470 0.036a 0.150
Hsa-miR-34c-5p −0.380 0.102 0.510 0.020a 0.274
Hsa-miR-662 −0.440 0.049a 0.210 0.370 0.195
Hsa-miR-767-5p −0.330 0.156 0.400 0.077 0.344

Statistical comparisons between cancerous and normal tissues in patients with gastric cancer_

miRNA ID Average Change 95% CI p Value
Hsa-miR-375-3p −1.943 −3.521/−0.365 0.018a
Hsa-miR-148a-3p −0.676 −2.085/0.731 0.324
Hsa-miR-196a-5p −1.299 −2.115/−0.483 0.003b
Hsa-miR-376c-3p −1.891 −3.160/−0.623 0.006b
Hsa-miR-129-5p −0.892 −1.726/−0.059 0.037a
Hsa-miR-34c-5p −1.482 −2.650/−0.314 0.016a
Hsa-miR-662 −0.922 −1.964/0.118 0.079
Hsa-miR-767-5p −2.387 −3.735/−1.040 0.001b

Exchange of miRNA expressions of cancerous and normal tissues of patients (2−ΔΔCt)_

Patient Code Hsa-miR-375-3p Hsa-miR-148a-3p Hsa-miR-196a-5p Hsa-miR-376c-3p Hsa-miR-129-5p Hsa-miR-34c-5p Hsa-miR-662 Hsa-miR-767-5p
GCM-01 3.158 −5.382 0.803 −0.238 2.043 1.498 0.598 2.113
GCM-02 −1.958 1.573 −0.613 −1.103 −0.228 −1.213 −0.803 −3.278
GCM-03 2.198 −1.248 1.348 0.631 1.173 0.723 1.083 1.008
GCM-04 4.570 −2.495 0.810 5.725 1.670 3.340 2.680 3.000
GCM-05 1.618 4.908 2.158 0.843 1.573 3.158 −0.858 0.753
GCM-06 −2.393 −0.268 −0.758 −2.853 −3.058 −3.078 4.128 −4.633
GCM-07 −8.520 4.720 −0.095 −5.420 −0.610 −1.855 −1.255 −4.633
GCM-08a −2.368 −2.553 −0.653 0.038 −0.498 0.618 −0.723 −1.958
GCM-09 −4.745 −0.085 −1.400 −4.415 −2.638 −1.905 −3.125 −5.945
GCM-10 −7.380 −3.240 −2.575 −4.335 −3.155 −5.810 −4.650 −6.015
GCM-11 −0.608 NA −1.318 −1.763 0.852 −1.723 −2.243 −1.998
GCM-12 −4.353 NA −3.178 −0.978 −2.053 −3.633 −3.653 −3.563
GCM-13 −3.673 −4.003 −3.613 −6.353 −4.053 −5.793 −4.688 −6.993
GCM-14 0.503 −1.293 −1.053 −1.048 −0.558 −0.608 0.543 0.688
GCM-15 0.788 −1.008 −1.208 −3.843 −0.533 −0.678 −0.203 −0.143
GCM-16 −0.3055 0.520 −3.315 −3.445 −2.595 −3.085 −0.225 −3.815
GCM-17 −2.360 −1.330 −3.095 −3.885 −2.750 −3.020 −2.560 −2.260
GCM-18 −3.005 −2.175 −1.395 −0.920 −1.040 −0.985 0.025 −2.495
GCM-19a −2.168 3.388 −3.003 −1.228 −0.473 −2.388 −1.403 −3.838
GCM-20 −5.110 −2.210 −3.840 −3.250 −0.930 −3.205 −1.125 −2.310

Evaluation of the demographic, clinical and pathological features of the 20 patients_

Variables n; mean ± SD; %

Age (years): 64.9±13.8
  <60 years old 7; 50.00±8.75; 35.0%
  >60 years old 13; 72.92±8.01; 65.0%

Gender:
  females 3; 15.0%
  males 17; 85.0%

Helicobacater pylori 3; 15.0%

Smoking 9; 45.0%

PPI/H2RB 5; 20.0%

Family history 1; 5.0%

Blood group:
  A Rh (+) 8; 40.0%
  O Rh (+) 5; 25.0%
  B Rh (+) 4; 20.0%
  A Rh (−) 1; 5.0%
  O Rh (−) 1; 5.0%
  AB Rh (+) 1; 5.0%

Preoperative:
  CEA (ng/mL) 12.94±21.75; normal: 0–5
  CA19-9 (U/mL) 122.64±217.83; normal: 0–27
  AFP (ng/mL) 2.84±1.60; normal: 0–7

Tumor location
  cardiac 10; 50.0%
  non cardiac 10; 50.0%

Differentiation:
  poorly differentiated 7; 35.0%
  mid differentiated 11; 55.0%
  well differentiated 2; 10.0%

Borman classification:
  type 1 9; 45.0%
  type 2 4; 20.0%
  type 3 7; 35.0%

pT:
  pT1 1; 5.0%
  pT2 0; 0.0%
  pT3 13; 65.0%
  pT4 6; 30.0%

pN:
  pN0 3; 15.0%
  pN1 4; 20.0%
  pN2 7; 35.0%
  pN3 6; 30.0%

Lymphpvascular invasion 18; 90.0%

Nerve invasion 14; 60.0%

Stage:
  I 1; 5.0%
  II 5; 25.0%
  III 14; 60.0%

miRNAs used in the study and their properties_

miRNA ID Accession Number; Sequence Expression Function Refs.
Hsa-miR-375-3p MIMAT0000728;UUUGUUCGUUCGGCUCGCGUGA downregulation apoptosis [10,11,12]
Hsa-miR-148a-3p MIMAT0000243;AAAGUUCUGAGACACUCCGACU downregulation DX; metastasis; invasion; poor prognosis [13]
Hsa-miR-196a-5p MIMAT0000226;AAAGUUCUGAGACACUCCGACU upregulation poor prognosis; DX [14,15]
Hsa-miR-376c-3p MIMAT0000720;AACAUAGAGGAAAUUCCACGU downregulation; upregulation apoptosis; cell proliferation 16,17]
Hsa-miR-129-5p MIMAT0000242;CUUUUUGCGGUCUGGGCUUGC downregulation poor prognosis [18,19]
Hsa-miR-34c-5p MIMAT0000686;AGGCAGUGUAGUUAGCUGAUUGC downregulation apoptosis; cell-cycle [20]
Hsa-miR-662 MIMAT0003325;UCCCACGUUGUGGCCCAGCAG downregulation unknown [21]
Hsa-miR-767-5p MIMAT0003882;UGCACCAUGGUUGUCUGAGCAUG downregulation cell proliferation; migration and invasion [22]
Język:
Angielski
Częstotliwość wydawania:
2 razy w roku
Dziedziny czasopisma:
Medycyna, Podstawowe nauki medyczne, Podstawowe nauki medyczne, inne