Comparison of PCR, Fluorescent in Situ Hybridization and Blood Cultures for Detection of Bacteremia in Children and Adolescents During Antibiotic Therapy

PCR	Antibiotic therapy prior to blood collection
PCR	n	%
Negative	12	24.5
Positive	37	75.5
Total	49	100.0
PCR	Antibiotic therapy after blood collection
PCR	n	%
Negative	14	32.6
Positive	29	67.4
Total	43	100.0
PCR	Total
PCR	n	%
Negative	26	28.3
Positive	66	71.7
Total	92	100.0

Amplification	Oligonucleotide	5’-3’	Origin	Target sequences
Bacteria	EXT_BAC_F	kGCGrACGGGTGAGTAA	(Gosiewski, Jurkiewicz-Badacz, et al. 2014)	16S rRNA
	EXT_BAC_R	CGCATTTCACCGCTA	(Gosiewski, Jurkiewicz-Badacz, et al. 2014)
	*GN/GP_F	GACTCCTACGGGAGGC	(Bispo et al. 2011)
	*GN/GP_R	GCGGCTGCTGGCAC
	GP_Probe	Hex – CTGAyssAGCAACGCCGCG – TAMRA (Q)
	GN_Probe	Cy5 – CCTGAysCAGCmATGCCGCG – BHQ-2
β-actin gene (amplification inhibition control)	F	GCCAGTGCCAGAAGAGCCAA	(Valle Jr et al. 2010)	Human β-actin gene
β-actin gene (amplification inhibition control)	R	TTAGGGTTGCCCATAACAGC	(Valle Jr et al. 2010)	Human β-actin gene
FISH	STA	CY3 – TCCTCCATATCTCTGCGC	(Kempf et al. 2000)	Staphylococcus spp. – 16S rRNA
	ENT 183	CY3-5’ – CTCTTTGGTCTTGCGACG	(Friedrich et al. 2003)	Enterobacteriaceae 16S rRNA
	EUB338	FITC – GCTGCCTCCCGTAGGAGT – FITC	(Amann et al. 1990)	All bacteria – 16S rRNA

Blood culture	Antibiotic therapy prior to blood collection
Blood culture	n	%
Negative	37	90.3
Positive	4	9.7
Total	41	100.0
Blood culture	Antibiotic therapy prior to blood collection
Blood culture	n	%
Negative	38	74.5
Positive	13	25.5
Total	51	100.0
Blood culture	Total
Blood culture	n	%
Negative	75	81.5
Positive	17	18.5
Total	92	100.0

FISH	Antibiotic therapy prior to blood collection
FISH	n	%
Negative	31	63.3
Positive	18	36.7
Total	49	100.0
FISH	Antibiotic therapy after blood collection
FISH	n	%
Negative	25	58.1
Positive	18	41.9
Total	43	100.0
FISH	Total
FISH	n	%
Negative	56	60.9
Positive	36	39.1
Total	92	100.0