Comparison of PCR, Fluorescent in Situ Hybridization and Blood Cultures for Detection of Bacteremia in Children and Adolescents During Antibiotic Therapy
, , , , oraz
10 gru 2018
O artykule
Kategoria artykułu: original-paper
Data publikacji: 10 gru 2018
Zakres stron: 479 - 486
Otrzymano: 26 cze 2018
Przyjęty: 15 wrz 2018
DOI: https://doi.org/10.21307/pjm-2018-056
Słowa kluczowe
© 2018 Tomasz W. Źródłowski et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.
Fig. 1.

Antibiotic therapy vs_ PCR results_
PCR | Antibiotic therapy prior to blood collection | |
n | % | |
Negative | 12 | 24.5 |
Positive | 37 | 75.5 |
Total | 49 | 100.0 |
PCR | Antibiotic therapy after blood collection | |
n | % | |
Negative | 14 | 32.6 |
Positive | 29 | 67.4 |
Total | 43 | 100.0 |
PCR | Total | |
n | % | |
Negative | 26 | 28.3 |
Positive | 66 | 71.7 |
Total | 92 | 100.0 |
Sequences of primers and probes (Genomed) utilized in this study_
Amplification | Oligonucleotide | 5’-3’ | Origin | Target sequences |
---|---|---|---|---|
Bacteria | EXT_BAC_F | kGCGrACGGGTGAGTAA | (Gosiewski, Jurkiewicz-Badacz, et al. | 16S rRNA |
EXT_BAC_R | CGCATTTCACCGCTA | |||
*GN/GP_F | GACTCCTACGGGAGGC | (Bispo et al. | ||
*GN/GP_R | GCGGCTGCTGGCAC | |||
GP_Probe | Hex – CTGAyssAGCAACGCCGCG – TAMRA (Q) | |||
GN_Probe | Cy5 – CCTGAysCAGCmATGCCGCG – BHQ-2 | |||
β-actin gene (amplification inhibition control) | F | GCCAGTGCCAGAAGAGCCAA | (Valle Jr et al. | Human β-actin gene |
R | TTAGGGTTGCCCATAACAGC | |||
FISH | STA | CY3 – TCCTCCATATCTCTGCGC | (Kempf et al. | |
ENT 183 | CY3-5’ – CTCTTTGGTCTTGCGACG | (Friedrich et al. | ||
EUB338 | FITC – GCTGCCTCCCGTAGGAGT – FITC | (Amann et al. | All bacteria – 16S rRNA |
Antibiotic therapy vs_ blood culture results_
Blood culture | Antibiotic therapy prior to blood collection | |
n | % | |
Negative | 37 | 90.3 |
Positive | 4 | 9.7 |
Total | 41 | 100.0 |
Blood culture | Antibiotic therapy prior to blood collection | |
n | % | |
Negative | 38 | 74.5 |
Positive | 13 | 25.5 |
Total | 51 | 100.0 |
Blood culture | Total | |
n | % | |
Negative | 75 | 81.5 |
Positive | 17 | 18.5 |
Total | 92 | 100.0 |
Antibiotic therapy vs_ FISH results_
FISH | Antibiotic therapy prior to blood collection | |
n | % | |
Negative | 31 | 63.3 |
Positive | 18 | 36.7 |
Total | 49 | 100.0 |
FISH | Antibiotic therapy after blood collection | |
n | % | |
Negative | 25 | 58.1 |
Positive | 18 | 41.9 |
Total | 43 | 100.0 |
FISH | Total | |
n | % | |
Negative | 56 | 60.9 |
Positive | 36 | 39.1 |
Total | 92 | 100.0 |