An integrative approach to the study of Helicotylenchus (Nematoda: Hoplolaimidae) Colombian and Brazilian populations associated with Musa crops

Root and soil samples were collected from banana and plantain rhizosphere crops in the departments of Quindío (Calarcá and Córdoba municipalities), Risaralda (La Celia municipality), and Valle del Cauca (Palmira and Buenaventura municipalities) in Colombia and in Janauba, Minas Gerais state, Brazil during 2015 to 2018. In each crop, compound samples were collected, comprising 15 to 20 plants/ha. Nematodes were extracted from roots and soil using a modification of Cobb’s method (Ravichandra, 2014). Afterwards, representative populations of Helicotylenchus were selected for posterior analysis in the microbiology and molecular biology laboratories of the National University of Colombia (Palmira, Valle del Cauca, Colombia) and the Laboratory of Nematology of the Biological Institute (Campinas, São Paulo, Brazil).

Nematodes extracted and identified as Helicotylenchus were killed with heat at 60°C for 4 min and fixated in 2% formalin. Semipermanent preparations were made and morphometric data were registered following Boag and Shamim Jairajpuri (1985) and Uzma et al. (2015). Microphotographs were taken using a compound microscope equipped with differential interference contrast–DIC (DM2500, Leica, Germany).

Morphometric data were analyzed using the Community Analysis Package (PISCES Conservation Ltd, Lymington UK, 1995) with principal components analysis (PCA) and conglomerate analysis to determine groupings and evaluate those characters that could discriminate species.

For molecular analysis, DNA was extracted by the Proteinase K method of Múnera et al. (2009) with modifications. A single nematode was crushed with a sterile scalpel and transferred to an Eppendorf tube with 15 µl of worm lysis buffer (50 mM KCl, 10 mM Tris pH 8.0, 15 mM MgCl2, 0.5% Triton x–100, 4.5% Tween–20, 0.09% Proteinase K). The tubes were incubated at −80°C (15 min), 65°C (1 h), and 95°C (15 min), centrifuged to 16,000 g (1 min) and stored at −20°C. Amplification of D2 to D3 expansion segment of the large subunit – LSU of ribosomal DNA (28S) was done using forward primer D2A (5′–ACAAGTACCGTGAGGGAAAGTTG–3′) and reverse D3B (5′–TCCTCGGAAGGAACCAGCTACTA–3′) (De Ley et al., 1999). The PCR conditions were initial denaturation during 2 min at 94°C followed by 40 cycles of 45 s at 94°C, 45 s at 55°C, and 1 min at 72°C and final extension of 10 min at 72°C. PCR products were sequenced in both directions at BIONNER Korea.

Consensus sequences were edited using the software Geneious (Kearse et al., 2012) and BLAST (Basic Local Alignment Search Tool) at NCBI (National Center for Biotechnology Information) was used to confirm the species’ identity of the sequences. To estimate the phylogenetic history of Helicotylenchus, D2 to D3 sequences of others specimens of the species were downloaded from GenBank, including a sequence of Rotylenchus magnus, which was used as outgroup. Sequence alignment was performed using MAFFT v7 (Katoh et al., 2002) (protocol Q-INS-i), and jModelTest v2.1.7 (Posada, 2008) to find the best nucleotide substitution model, based on the Akaike information criterion corrected for small sample sizes. Afterwards maximum likelihood (ML) was used to estimate a tree with 250 bootstraps and the general time reversible model with allowance for gamma distribution of rate variation (GTR+Γ) in RAxML v8 (Stamatakis, 2014). The phylogeny of Helicotylenchus was inferred using MrBayes v3.2.6 (Ronquist et al., 2012) with the GTR + Γ model. Two independent Metropolis-coupled Markov chain Monte Carlo (MCMCMC) searches were performed for 2 million generations sampling every 2,000 steps. Convergence was assessed using Tracer v1.5 (burn-in = 20% of the samples), and by examining the average standard deviation of split frequencies among parallel chains. The consensus tree was calculated from the posterior distribution of 1,600 phylogenies. The Bayesian analysis was performed in the CIPRES Science Gateway (Miller et al., 2010).

Four species of Helicotylenchus were identified in the study areas: H. multicinctus, H. dihystera, H. erythrinae, and H. californicus. Morphological and morphometric data from each species closely resembled type and reference populations species (Tables 1-4).

Helicotylenchus multicinctus populations were identified in plantain crops of Colombia (Córdoba, Quindío and Rozo, Valle del Cauca) and banana crops of Brazil (Minas Gerais). Morphologically, these populations show a habitus post-mortem open C form, a hemispherical cephalic region, the shape of the stylet knobs flattened anteriorly and rounded posteriorly, a rounded tail, functional spermatheca and males present (Fig. 1, Table 1).

Figure 1:

Populations of H. dihystera were founded in plantain and banana crops from Colombia (Córdoba, Quindío). Morphologically, the populations of this species show a habitus post-mortem with a spiral shape, a hemispherical cephalic region with the shape of stylet knobs indented or flattened anteriorly and rounded posteriorly, a conoide tail and males absent (Fig. 2, Table 2).

Figure 2:

The populations identified as H. erythrinae occurred in Colombian plantain and banana crops (Calarcá, Quindío and La Celia, Risaralda). Morphologically, the populations of this species show a habitus post-mortem of a loose spiral, a hemispherical cephalic region with the shape of stylet knobs indented or flattened anteriorly and rounded posteriorly, a tail with a long ventral projection, females with functional spermatheca and males present (Fig. 2, Table 3).

The species H. californicus was identified in a plantain crop from Colombia (Delfina–Buenaventura, Colombia) and a banana crop from Brazil (Minas Gerais). Morphologically, these populations presented a habitus post-mortem in a spiral, a hemispherical cephalic region with the shape of stylet knobs flattened anteriorly and rounded posteriorly, an irregular tail with a short sharply pointed or blunt ventral projection and males present (Fig. 2; Table 4).

PCA and conglomerate analysis separated the species into four groups (H. multicinctus, H. dihystera, H. erythrinae, and H. californicus) (Figs. 3, 4). The principal components 1 to 4 have eigenvalues greater than or equal to 1 and explain 91.39% of variance (Table 5). However, PC1 and PC2 axes better separated the species. In PC1, the most discriminating variables were maximum body diameter, the number of tail annuli, and ratio c′, while in PC2 they were vulva position, anal body diameter, and tail length (Table 6).

Figure 3:

Figure 4:

In relation to the D2 to D3 expansion segment of ribosomal DNA, four consensus sequences were obtained for H. multicinctus with similarity of 99% with different sequences of this species deposited in the NCBI (KF443214, DQ328745, DQ328746, HM014290, HM014291, and HM014292). On the other hand, two consensus sequences were obtained for H. dihystera, which presented similarity of 99% with other sequences of this species already deposited in NCBI (HM014251, KF486503, HM014250, HM014245, HM014246, HM014247, HM014248, HM014249, KM506834, KM506835, and KM506836). Molecular identity of the sequence obtained from the individual morphologically identified as H. erythrinae was not confirmed, because there are no reference sequences of H. erythrinae in NCBI or any other molecular database. When BLAST was performed, no sequence deposited in NCBI presented similarity greater than or equal to 99% with the sequence obtained in this research for H. erythrinae and closer sequences were of H. labiodiscinus with a similarity of 90.85 to 91.03% (HM014293; HM014294; HM014295). For individuals identified morphologically as H. californicus were obtained four sequences that showed similarity of 99% with an isolate of Helicotylenchus sp. labeled as CD761, with accession numbers KM506844 and KM506845. The sequences obtained in this study for individuals identified morphologically as H. erythrinae and H. californicus are proposed as standard and reference populations until topotype specimens become available and were molecularly characterized. All sequences obtained in the present study were deposited in NCBI with accession numbers MT321729-MT321739 (Table 7).

The evolutionary relationships of 51 sequences of the D2 to D3 expansion segment of ribosomal DNA for Helicotylenchus, including those obtained in the present study (Table 7), are depicted in Figures 5 and 6. The sequences of H. multicinctus obtained in this research clustered in the same clade with other sequences of this species, including some populations from Musa sp. plantations, such as DQ328745 and DQ328746 from Sudan, HM014290 and HM014291 from Lambani, South Africa, and KF443214 from Fujian, China. Monophyly of this species was recovered both with maximum likelihood (bootstrap support or BS = 96%) and Bayesian inference (posterior probability of PP = 1). Likewise, the sequences of H. dihystera from Colombia obtained in this research, grouped in the same clade with other sequences of that species, including HM014248 and HM014250 from grasses in Hawaii and KF486503 from Musa sp. in Fujian, China (BS = 95%, PP = 1). The sequence of H. erythrinae grouped with the clade of H. labiodiscinus, although the support for this group was weak (BS = 63%, PP = 0.75). Finally, the sequences of H. californicus formed a clade with a sequence of Helicotylenchus sp. isolate CD761 from Calathea in USA (KM506844) (BS = 98%, PP = 1). These results support the presence of four species of Helicotylenchus in the Musa crops that were sampled.

Figure 5:

Figure 6: