Yellow nutsedge (
Additional research on the morphology and host range conducted at Virginia Tech and New Mexico State University revealed several unusual morphological characters and a unique host range that indicated it was a new species. The perineal pattern, shape of the female stylet, and shape of the male head and stylet were unique and different from those of any other described species.
Males and second-stage juveniles (J2) were extracted from washed galled roots incubated in a moist chamber. Light microscopy (LM) observations were made from specimens mounted on 5% water agar pads and paralyzed with 0.1 m sodium azide (Eisenback, 2012). Females and J2 were prepared for scanning electron microscopy (SEM) according to Eisenback (1985). Perineal patterns were prepared for SEM according to Charchar and Eisenback (2001). They were observed and photographed by LM with negative contrast as reported by Eisenback (2012). Eggs were measured in fresh tap water mounted on agar pads. All LM observations except for perineal patterns were made with a bright field microscope, and at least 100 specimens were observed. However, only two males were recovered from hundreds of infected nutsedge plants. Measurements were made of females in 2% glutaraldehyde in 0.1 M cacodylic acid buffer, pH 7.2; perineal patterns were mounted in glycerin, and extracted stylets (Eisenback et al., 1980) were measured with the SEM. In total, 30 specimens of J2 and females were randomly selected for measurements along with the two males.
Seedlings of alfalfa (
In total, 24 individual females were isolated from nutsedge roots and transferred into separate polymerase chain reaction (PCR) tubes containing 20 μl of lysis buffer (0.2 M Tris-Cl, pH 7.8) and stored at −20°C.
Lysis was performed using a rapid single tube lysis procedure (Solano and Hanson, unpubl. data). Briefly, samples were removed from −20°C and incubated at 90°C for 10 min. After heating, 30 μl of Proteinase K digestion mixture was added to each sample (5 μl Proteinase K (Qiagen Inc., Valencia, CA), 3 μl of 10× Platinum Taq DNA Polymerase PCR Buffer (Invitrogen, Carlsbad CA), and 22 μl water per sample). Samples were then sonicated for 8 min in a Branson 2510 ultrasonic cleaner then incubated for 30 min at 60°C. After Proteinase K digestion samples were frozen at −80°C for 10 min then incubated at 90°C for 10 min. After heating, 50 μl of water was added to each tube and samples were well mixed then stored at −20°C prior to PCR.
Sequence-based identification of individual nematodes was performed using 18S rRNA and heat shock protein 90 (
Primers used to compare
Primer | Sequence (5′-3′) | Use | Marker |
---|---|---|---|
D2A | ACAAGTACCGTGAGGGAAAGTTG | PCR and sequencing | 18S rRNA |
D2B | TCGGAAGGAACCAGCTACTA | PCR and sequencing | 18S rRNA |
ITS1 | CGTAACAAGGTAGCTGTAG | PCR and sequencing | ITS rRNA |
ITS2 | TTTCACTCGCCGTTACTAAGG | PCR and sequencing | ITS rRNA |
1618 F | TTT GTA CAC AC GCC CGT CG | Sequencing | 18S rRNA |
1421 F deg | GGT CTG TGA TGC CCT WRG ATG T | Sequencing | 18S rRNA |
546 F | GGG CAA GTC TGG TGC CAG CAG | Sequencing | 18S rRNA |
Nema 28 S R AG | ACT CCT TGG TCC GTG TTT CAA GA | PCR | 18S rRNA |
983 F deg | CGA MRG YGA TYA GAT ACC GCY | PCR | 18S rRNA |
1629 R deg | GGT GTG TAC AAA KSR CAG GGA | PCR | 18S rRNA |
79 F deg | GDG AAACYG CGWACG GCT | PCR | 18S rRNA |
RKN-5R | TCG AAC ATG TCA AAA GGA GC | PCR and sequencing | HSP90 |
RKN-d1F | GCY GAT CTT GTY AAC AAC CYT GGA AC | PCR and sequencing | HSP90 |
For the amplification of the D2-D3 region of the 28S rRNA, the forward D2A (5′-ACAAGTACCGTGAGGGAAAGTTG-3′) and the reverse D3B (5′-TCGGAAGGAACCAGCTACTA-3′) primers were used (De Ley et al., 1999). For amplification of the ITS1/ITS2 region of the rRNA, the forward primer 5′-CGTAACAAGGTAGCTGTAG-3′ (Ferris et al., 1993) and reverse primer 5′-TTTCACTCGCCGTTACTAAGG-3′ (Vrain, 1993) were used. The primers 5′-GGTCAATGTTCAGAAATTTGTGG-3′ and 5′-TACCTTTGACCAATCACGCT-3′ were used to amplified intergenic region between the cytochrome oxidase subunit II (COII)-16S rRNA of mitochondrial DNA (mtDNA) region (Powers and Harris, 1993). Accession numbers for all of the sequences of
Systematics
Females of
Scanning electron (SEM) and light micrographs of females of
Light micrographs of perineal patterns of females of
Light (LM) and scanning electron micrographs (SEM) of females of
Light micrographs of a whole male specimen with an enlarged view of the anterior end of
(A) Scanning electron micrograph of the anterior end of a second-stage juvenile of
Light micrographs of the anterior ends and tails of second-stage juveniles of
Measurements and ratios of
Female | Male | Second-stage Juv. | ||
---|---|---|---|---|
Character | Holotype | Paratypes | Paratypes | Paratypes |
N | – | 30 | 2 | 30 |
L | 360 | 373 ± 44 | 1124 ± 10.5 | 426 ± 24.7 |
– | (310–460) | (1113–1134) | (388–484) | |
Body diam. | 292 | 306 ± 46 | 30.9 ± 1.4 | 15 ± 0.9 |
– | (210–420) | (29.5–32.3) | (13.6–17.4) | |
Neck length | 148 | 153 ± 27 | – | – |
– | (100–210) | – | – | |
Stylet length | 12 | 12 ± 0 | 15.6 ± 1.0 | 10.9 ± 0.4 |
– | (12–12) | (14.6–16.5) | (10.1–11.8) | |
Stylet knob height | 1.5 | 1.5 ± 0.2 | 2.3 ± 0.2 | 1.4 ± 0.2 |
– | (1.2–1.9) | (2–2.5) | (1.1–1.9) | |
Stylet knob width | 2.4 | 2.6 ± 0.3 | 4.1 ± 0.1 | 2.1 ± 0.2 |
– | (2–3) | (4–4.2) | (1.7–2.5) | |
DGO | 4.8 | 4.8 ± 0.6 | 3.1 ± 0.1 | 3.7 ± 0.5 |
– | (4–6.1) | (3.0–3.3) | (2.7–4.8) | |
Stylet tip to metacorpus center | 60.1 | 63.8 ± 2.2 | – | – |
– | (59–67) | – | – | |
Interphasmidial distance | – | 18 ± 2.7 | – | – |
– | (14.2–24.4) | – | – | |
Vulva length | – | 21 ± 2.9 | – | – |
– | (13.5–26) | – | – | |
Vulva-anus distance | – | 15.7 ± 2.3 | – | – |
– | (10.9–21) | – | – | |
Ant. end to excretory pore | – | – | 94.7 ± 1.6 | 68.5 ± 7.9 |
– | – | (93.1–96.3) | (52–80.4) | |
Tail length | – | – | 12.7 ± 1.9 | 73.1 ± 4.9 |
– | – | (10.8–14.5) | (63.6–88.7) | |
Body width at anus | – | – | – | 11 ± 0.6 |
– | – | – | (10.2–11.9) | |
a | 1.3 | 1.2 ± 0.2 | – | 28.4 ± 2.8 |
– | (0.8–1.7) | – | (23.6–34.6) | |
c | – | – | – | 5.8 ± 0.4 |
– | – | – | (5.1–6.5) | |
Spicule length | – | – | 23.6 ± 1.8 | – |
– | – | (21.8–25.4) | – | |
Hyaline tail terminus | – | – | – | 22 ± 2.0 |
– | – | – | (18.5–26.6) |
Mature females with their egg masses are usually contained completely inside galled root tissues. They are very small (373 µm long) and pearly white. Their body shape is unique from many other species because the neck is often at a 90 to 130° angle to the protruding posterior end that contains the perineal pattern. Lip region low, cephalic framework weakly developed, with one head annule. The cone of the stylet slightly curved dorsally, posterior edges of the knobs angular, and tapering onto the shaft. The distance of the dorsal esophageal gland orifice (DGO) to the base of the stylet relatively long (4–6 µm). Excretory pore level, with the base of the stylet, is present. The lining of the metacorpus triradiate, with the posterior and anterior portions rounded. Numerous (3–10) small vesicles present in the anterior metacorpus. Two, small, rounded esophago-intestinal cells at the base of the metacorpus, followed by a large nucleated dorsal esophageal gland lobe with two smaller nucleated subventral esophageal gland cells. The didelphic ovary is typical for the genus. Six, large rectal gland cells connect to the rectum and produce the gelatinous matrix forming the egg mass. The perineal pattern is raised on a protuberance at the posterior end of the body. It contains a rounded dorsal arch with a tail terminal area that is usually smooth, but may be marked with thick lines and many horizontal, rope-like striae. Phasmids are typical for the genus. The vulval lips are usually flattened, but they may be rounded and slightly protruding. Smooth, regular striae surround the vulva and tail terminal area and give the appearance of a dorso-ventrally elongated oval pattern.
The characteristics are as follows: anterior end tapering, labial disc slightly concave around the stoma, one distinct head annule, cephalic framework slight, stylet shaft tapering posteriorly. Body twisting 90° throughout its length. Stylet knobs rounded and set-off from the shaft. The distance of the DGO to the base of the stylet is long (3–3.3 µm). Esophageal glands overlapping the intestine ventrally. Four lines in the lateral field. Paired spicules with gubernaculum are typical for the genus. Tail tip slightly set-off from the remainder of the body.
It has a body with a very long tail and tail terminus. Cephalic framework is weak, stylet is small, with a constriction near the junction of the shaft and knobs. In SEM, the head has a slit-like oral opening placed on the rounded labial disc and surrounded by six small pit-like openings of the inner labial sensilla. Small depressions in the cuticle on the dorsal and ventral lip pairs mark the outer labial sensilla. Rounded knobs, tapering onto the shaft, are present. The distance of the DGO to the base of the stylet is long (3–5 µm). Esophageal glands overlap the intestine ventrally. Four lines in the lateral field are present. The tail is very long (64–89 µm) and the hyaline portion of the tail is very narrow, making the tail finely pointed. Phasmids are located midway between anus and tail tip.
Eggs are typical in shape for the genus and vary in length [91.6 ± 2.3 (85.2–99.8 µm)] and width [39.7 ± 0.1 (37.1–48.1 µm)], having a L/W ratio of [2.3 ± 0.1 (2.1–2.6). In one single mass of eggs, one egg was smaller than usual (69 × 43 µm), one was normal (95 × 42 µm), and one was large (125 × 43 µm), even though all were in a two-cell stage.
DNA sequences were manually edited to remove low quality sequence and PCR priming regions prior to making assemblies for both the 18S rRNA and
Maximum likelihood trees comparing
Maximum likelihood phylogenetic analysis of evolutionary relationships of closely related
Maximum likelihood phylogenetic analysis of evolutionary relationships of closely related
The new species was also molecularly characterized using the D2-D3 fragment of the 28S rRNA, the ITS region of the rRNA, and the COII-16S rRNA region. In this case, only a single amplicon was sequenced for each of these
Maximum likelihood phylogenetic analysis of evolutionary relationships of closely related
Maximum likelihood phylogenetic analysis of evolutionary relationships of closely related
Maximum likelihood phylogenetic analysis of evolutionary relationships of closely related
Taken together, the congruent topologies obtained for all the tested molecular
Lower Rio Grande Valley, Dona Ana County, New Mexico onion field on purple nutsedge (Rincon/Hatch Hwy 185, onion field, N32 39.431 W107 07.801).
The original population was derived from the type locality and host. Holotype female and 6 females and 10 second-stage juvenile paratypes isolated from a single egg mass and maintained on purple nutsedge in a greenhouse were deposited in the USDA Nematode Collection (USDANC), Beltsville, Maryland. Paratypes (3 females and 10 J2) were deposited in the Canadian National Collection of Nematodes, Ottawa, Canada.
The most important measurements of females, males, and second-stage juveniles of
Comparisons of key measurements of females, second-stage juveniles, and males of
|
|||||
Species | Length | Width | Stylet | DGO | Vulva |
|
(430–750) 591 | (344–518) 422 | (11.2–12.5) 11.9 | (3.4–5.5) 4.2 | |
|
(404–720) 491 | (256–464) 362 | (13.9–15.2) 14.5 | (3.8–6.3) 4.3 | (20.2–28.4) 24.7 |
|
(416–608) 526 | (240–464) 339 | (12.6–15.2) 14.2 | (3.2–6.3) 4.1 | (22.8–29.1) 25.8 |
|
(455–705) 557 | (227–398) 330 | (11–15) 13 | (2–4) 3 | (17–25) 22 |
|
(455–765) 573 | (275–520) 419 | (10.6–11.2) 11.1 | (2.8–3.9) 3.2 | |
|
(310–460) 373 | (210–420) 306 | (12–12) 12 | (4–6.1) 4.8 | (13.5–26) 21 |
|
|||||
Species | Length | Stylet | DGO | Tail | Terminus |
|
(336–417) 390 | (9.0–10.3) 9.9 | (2.6–3.9) 3.2 | (39–47) 43 | (8.6–13.8) 11 |
|
(381–435) 403 | (10.1–11.4) 10.8 | (3.2–3.8) 3.5 | (46.1–55.6) 49.3 | (12.2–15.8) 13.5 |
|
(310–416) 377 | (7.6–10.1) 9.2 | (3.2–4.4) 3.8 | (58.1–77.1) 54 | (12.0–22.1) 16.1 |
|
(418–465) 435 | (13–15) 14 | (2–3) 2.4 | (52–78) 70 | 17.5 |
|
(415–484) 441 | (11.2–12.3) 11.4 | (2.8–3.4) 2.8 | (67.0–76.0) 70.9 | (14.0–21.2) 17.9 |
|
(388–484) 426 | (10.1–11.8) 10.8 | (2.7–4.8) 3.7 | (63.6–88.7) 73.1 | (18.5–26.6) 22 |
|
|||||
Species | Stylet | DGO | |||
|
(18.1–18.5)18.3 | (2.2–3.4) 3 | |||
|
(18.9–20.9) 19.6 | (3.2–5.7) 4.4 | |||
|
(17.1–19.0) 17.8 | (3.2–4.4) 3.8 | |||
|
(16–19) 18 | (2–4) 3 | |||
|
(16.2–17.4) 16.8 | (2.8–3.9) 3.3 | |||
|
(14.6–16.5) 15.6 | (3.0–3.3) 3.1 |
Length = maximum body length; Width = maximum body width; Stylet = maximum stylet length; DGO = length of the dorsal gland orifice to the base of the stylet knobs; Vulva = maximum width of the vulva; Tail = distance from the anus to the tail tip; Terminus = distance of the hyaline portion of the tail to the tip of the tail.
a Golden et al. (1980); b Karssen (1996); c Karssen et al. (2004); d Franklin (1965); eGolden and Birchfield (1965).
Comparisons of males of these three species reveal that the DGO is very similar (3–3.1 µm), but the length of the stylet is quite dissimilar [
The host ranges of
Hosts and non-host plants of
August 13, 2008 - planted and inoculated with 5,000 per pot.
*Franklin, 1965;**Radewald et al., 1970; †Allen et al., 1970; and ‡Michell et al., 1973 tested populations from England, California, Illinois, Kansas, and Kentucky; aProportion of 10 plants that exhibited host characteristics; bpoor host = RF (ratio of eggs recovered/inoculum level) > 0 but < 1; host = RF > 1 but < 10; good host = RF > 10; red = non or poor host, yellow = non and good host, and green = good host.
The common hosts of