Accesso libero

Methodological Evaluation of Carbapenemase Detection by Different Methods

, , , ,  e   
13 set 2024
INFORMAZIONI SU QUESTO ARTICOLO

Cita
Scarica la copertina

Fig. 1.

Apb/EDTA method for the detection of carbapenemase
Apb/EDTA method for the detection of carbapenemase

Fig. 2.

A) Electrophoretic bands showed positive KPC; B) electrophoretic bands showed positive NDM
A) Electrophoretic bands showed positive KPC; B) electrophoretic bands showed positive NDM

Fig. 3.

NG-test Carba 5 demonstration of carbapenemase detection.
NG-test Carba 5 demonstration of carbapenemase detection.

Fig. 4.

A represents the fluorescence diagram of DETECTR for pre-experimental detection of KPC gene NDM gene amplification, and B represents the partial fluorescence display diagram of carbapenemase detection with DETECTR.
A represents the fluorescence diagram of DETECTR for pre-experimental detection of KPC gene NDM gene amplification, and B represents the partial fluorescence display diagram of carbapenemase detection with DETECTR.

Fig. 5.

Characterization of five carbapenemase methods for detecting specimen No. 36.
A) mAPB/EDTA method (panel A) ertapenem (10 mg), 6 mm; (panel B) ertapenem plus APB (300 mg), 6 mm; (panel C) ertapenem plus EDTA (292 mg), ≥ 11 mm; (panel D) ertapenem plus APB and EDTA, ≥ 11 mm; judged as carbapenemase category B positive. B) PCR: NDM negative. C) NG-test Carba 5: NDM negative. D) GeneXpert Carba-R: NDM positive. E) DETECTR: NDM positive.
Characterization of five carbapenemase methods for detecting specimen No. 36. A) mAPB/EDTA method (panel A) ertapenem (10 mg), 6 mm; (panel B) ertapenem plus APB (300 mg), 6 mm; (panel C) ertapenem plus EDTA (292 mg), ≥ 11 mm; (panel D) ertapenem plus APB and EDTA, ≥ 11 mm; judged as carbapenemase category B positive. B) PCR: NDM negative. C) NG-test Carba 5: NDM negative. D) GeneXpert Carba-R: NDM positive. E) DETECTR: NDM positive.

Results of carbapenemase detection using five assays_

No. WGS APB/EDTA NG-test Carba 5 PCR DETECTR geneXpert
1–7381-kp KPC-2 category A KPC KPC KPC KPC
2–7592-kp KPC-2 category A KPC KPC KPC KPC
3–4619-kp NDM-1 category B NDM NDM NDM NDM
4–7135-kp KPC-2 category A KPC KPC KPC KPC
5–7056-E. coli NDM-1 category B NDM NDM NDM NDM
6–4375-kp NDM-1 category B NDM NDM NDM NDM
7–6553-kp KPC-2 category A KPC KPC KPC KPC
8–8247-kp KPC-2 category A KPC KPC KPC KPC
9-8046-kp KPC-2 category A KPC KPC KPC KPC
10-9261-kp NDM-1 category B NDM NDM NDM NDM
11-4963-kp NDM-1 category B NDM NDM NDM NDM
12-6310-kp NDM-1 category B NDM NDM NDM NDM
13-7353-kp NDM-1 category B NDM NDM NDM NDM
14-4530-kp NDM-1 category B NDM NDM NDM NDM
15-4658-kp NDM-1 category B NDM NDM NDM NDM
16-6441-kp NDM-1 category B NDM NDM NDM NDM
17-7984-E. coli NDM-1 category B NDM NDM NDM NDM
18-8961-kp KPC-2 category A KPC KPC KPC KPC
19-7862-E. coli NDM-1 category B NDM NDM NDM NDM
20-8024-kp KPC-2 category A KPC KPC KPC KPC
21-7926-kp KPC-2 category A KPC KPC KPC KPC
22-4420-kp NDM-1 category B NDM NDM NDM NDM
23-8986-kp KPC-2 category A KPC KPC KPC KPC
24-9990-kp KPC-2 category A KPC KPC KPC KPC
25-7005-kp NDM-1 category B NDM NDM NDM NDM
26-7615-kp KPC-2 category A KPC KPC KPC KPC
27-4480-kp KPC-2 category A KPC KPC KPC KPC
28-9899-E. coli NDM-1 category B NDM NDM NDM NDM
29-4650-kp KPC-2 category A KPC KPC KPC KPC
30-7972-kp KPC-2 category A KPC KPC KPC KPC
31-6993-E. coli NDM-1 category B NDM NDM NDM NDM
32-4610-kp KPC-2 category A KPC KPC KPC KPC
33-7985-kp KPC-2 category A KPC KPC KPC KPC
34-7407-kp NDM-1 category B NDM NDM NDM NDM
35-4812-E. coli NDM-1 category B NDM NDM NDM NDM
36-7467-kp NDM-1 category B Not detected Not detected NDM NDM
37-7973-kp KPC-2 category A KPC KPC KPC KPC
38-6887-kp NDM-1 category B NDM NDM NDM NDM
39-6186-kp KPC-2 category A KPC KPC KPC KPC
40-9059-kp KPC-2 category A KPC KPC KPC KPC
41-7519-kp KPC-2 category A KPC KPC KPC KPC
42-8918-kp NDM-1 category B NDM NDM NDM NDM
43-9777-kp KPC-2 category A KPC KPC KPC KPC
44-6434-kp KPC-2 category A KPC KPC KPC KPC
45-6440-kp NDM-1 category B NDM NDM NDM NDM
46-7820-kp KPC-2 category A KPC KPC KPC KPC
47-6071-kp KPC-2 category A KPC KPC KPC KPC
48-6322-kp KPC-2 category A KPC KPC KPC KPC
49-4865-E. coli NDM-1 category B NDM NDM NDM NDM
50-8052-kp NDM-1 category B NDM NDM NDM NDM
51-4906-kp KPC-2 category A KPC KPC KPC KPC
52-7979-kp KPC-2 category A KPC KPC KPC KPC
53-4669-E. coli NDM-1 category B NDM NDM NDM NDM
54-4947-kp NDM-1 category B NDM NDM NDM NDM
55-7052-kp NDM-1 category B NDM NDM NDM NDM
56-10015-kp NDM-1 category B NDM NDM NDM NDM
57-4919-kp KPC-2 category A KPC KPC KPC KPC
58-7380-E. coli NDM-1 category B NDM NDM NDM NDM

Oligonucleotide sequences used in this study_

Primer name Sequence (5’–3’) Size of product (bp) References
KPC-F ATCTCGGAAAAATATCTGACAACAGGCATGACGGTG 309 [14]
KPC-R CGGTCGTGTTTCCCTTTAGCCAATCAACAAAACTGCT
NDM-F TCGCACCGAATGTCTGGCAGCACACTTCCTAT 278 [14]
NDM-R GTTCGACAACGCATTGGCATAAGTCGCAATCC

Xpert Carba-R assay results by target carbapenemase genes_

Xpert Carba-R assay results Specimens (n = 58)
KPC 29
IMP 0
NDM 29
OXA-48 0
VIM 0

Carbapenemase-resistant spectra of the 58 strains_

Antimicrobial S I R
Amikacin 36 22
Ertapenem 58
Imipenem 1 57
Meropenem 1 57
Cefazolin 1 57
Ceftazidime and avibactam 20 38
Cefepime 58
Aztreonam 12 46
Amoxicillin and clavulanate potassium 1 57
Polymyxin 57 1
Levofloxacin 2 9 47
Tigecycline 50 1 7
Lingua:
Inglese
Frequenza di pubblicazione:
4 volte all'anno
Argomenti della rivista:
Scienze biologiche, Microbiologia e virologia