Accesso libero

Establishment of a Nucleic Acid Detection Method for Norovirus GII.2 Genotype Based on RT-RPA and CRISPR/Cas12a-LFS

Ting Wang

Ting Wang

School of Biomedical and Pharmaceutical Sciences, Shaanxi University of Science and TechnologyXian, China
Profilo Orcid
Cerca questo autore su
Sciendo|Google Scholar
Wang, Ting
, 
Hao Zeng

Hao Zeng

School of Biomedical and Pharmaceutical Sciences, Shaanxi University of Science and TechnologyXian, China
Cerca questo autore su
Sciendo|Google Scholar
Zeng, Hao
, 
Jie Kang

Jie Kang

Shaanxi Institute of Supervision and Testing on Product QualityXian, China
Cerca questo autore su
Sciendo|Google Scholar
Kang, Jie
, 
Lanlan Lei

Lanlan Lei

Shaanxi Institute of Supervision and Testing on Product QualityXian, China
Cerca questo autore su
Sciendo|Google Scholar
Lei, Lanlan
, 
Jing Liu

Jing Liu

Shaanxi Institute of Supervision and Testing on Product QualityXian, China
Cerca questo autore su
Sciendo|Google Scholar
Liu, Jing
, 
Yuhong Zheng

Yuhong Zheng

Shaanxi Institute of Supervision and Testing on Product QualityXian, China
Cerca questo autore su
Sciendo|Google Scholar
Zheng, Yuhong
, 
Weidong Qian

Weidong Qian

School of Biomedical and Pharmaceutical Sciences, Shaanxi University of Science and TechnologyXian, China
Cerca questo autore su
Sciendo|Google Scholar
Qian, Weidong
 e 
Cheng Fan

Cheng Fan

Shaanxi Institute of Supervision and Testing on Product QualityXian, China
Cerca questo autore su
Sciendo|Google Scholar
Fan, Cheng
  
20 giu 2024
Establishment of a Nucleic Acid Detection Method for Norovirus GII.2 Genotype Based on RT-RPA and CRISPR/Cas12a-LFS's Cover Image
INFORMAZIONI SU QUESTO ARTICOLO
Articolo precedente
Articolo Successivo
Cita
Scarica la copertina
Categoria dell'articolo: Original Paper
Pubblicato online: 20 giu 2024
Pagine: 253 - 262
Ricevuto: 09 mar 2024
Accettato: 09 mag 2024
DOI: https://doi.org/10.33073/pjm-2024-023
Parole chiave
© 2024 Ting Wang et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1.

Screening of the optimal primer pair for RT-RPA for detection of norovirus GII.2. a) The amplification efficiency of RT-RPA with various primer combinations was assessed using gel electrophoresis; b) the amplification efficiency of RT-RPA with various primer combinations was evaluated using LFS, driven by the cleavage activity mediated by the complex of Cas12a and the target amplified product. M – DL2000 marker; F1R1 – primer pairs of NoV-GII.2-F1/NoV-GII.2-R1; F1R2 – primer pairs of NoV-GII.2-F1/NoV-GII.2-R2; F2R1 – Primer pairs of NoV-GII.2-F2/NoV-GII.2-R1; F2R2 – primer pairs of NoV-GII.2-F2/NoV-GII.2-R2; F12R12 – primer pairs of NoV-GII.2-F1/NoV-GII.2-F2 and NoV-GII.2-R1/NoV-GII.2-R2; NC – negative control. In the context of LFS, T denotes the testing line, while C represents the quality control line.
Screening of the optimal primer pair for RT-RPA for detection of norovirus GII.2. a) The amplification efficiency of RT-RPA with various primer combinations was assessed using gel electrophoresis; b) the amplification efficiency of RT-RPA with various primer combinations was evaluated using LFS, driven by the cleavage activity mediated by the complex of Cas12a and the target amplified product. M – DL2000 marker; F1R1 – primer pairs of NoV-GII.2-F1/NoV-GII.2-R1; F1R2 – primer pairs of NoV-GII.2-F1/NoV-GII.2-R2; F2R1 – Primer pairs of NoV-GII.2-F2/NoV-GII.2-R1; F2R2 – primer pairs of NoV-GII.2-F2/NoV-GII.2-R2; F12R12 – primer pairs of NoV-GII.2-F1/NoV-GII.2-F2 and NoV-GII.2-R1/NoV-GII.2-R2; NC – negative control. In the context of LFS, T denotes the testing line, while C represents the quality control line.

Fig. 2.

Screening of the optimal concentration of the primer pair for RT-RPA-Cas12a-LFS to detect norovirus GII.2. a) The amplification efficiency of RT-RPA with different primer concentrations was examined using gel electrophoresis; b) the amplification efficiency of RT-RPA with various primer concentrations was assessed using LFS, facilitated by the cleavage activity mediated by the complex of Cas12a and the target amplified product. In the context of LFS, T denotes the testing line, while C represents the quality control line.
Screening of the optimal concentration of the primer pair for RT-RPA-Cas12a-LFS to detect norovirus GII.2. a) The amplification efficiency of RT-RPA with different primer concentrations was examined using gel electrophoresis; b) the amplification efficiency of RT-RPA with various primer concentrations was assessed using LFS, facilitated by the cleavage activity mediated by the complex of Cas12a and the target amplified product. In the context of LFS, T denotes the testing line, while C represents the quality control line.

Fig. 3.

Screening of the optimal reaction time of RT-RPA for RT-RPA-Cas12a-LFS to detect norovirus GII.2. a) The amplification efficiency of RT-RPA with different reaction times was determined using gel electrophoresis; b) The amplification efficiency of RT-RPA with different reaction times was analyzed using LFS, facilitated by the cleavage activity mediated by the complex of Cas12a and the target amplified product. In the context of LFS, T denotes the testing line, while C represents the quality control line.
Screening of the optimal reaction time of RT-RPA for RT-RPA-Cas12a-LFS to detect norovirus GII.2. a) The amplification efficiency of RT-RPA with different reaction times was determined using gel electrophoresis; b) The amplification efficiency of RT-RPA with different reaction times was analyzed using LFS, facilitated by the cleavage activity mediated by the complex of Cas12a and the target amplified product. In the context of LFS, T denotes the testing line, while C represents the quality control line.

Fig. 4.

The specificity analysis of RT-RPA-Cas12a-LFS with various viral genome samples was assessed using gel electrophoresis (a) and LFS (b). In the context of LFS, T denotes the testing line, while C represents the quality control line.
The specificity analysis of RT-RPA-Cas12a-LFS with various viral genome samples was assessed using gel electrophoresis (a) and LFS (b). In the context of LFS, T denotes the testing line, while C represents the quality control line.

Fig. 5.

The sensitivity analysis of RT-RPA-Cas12a-LFS for detection of norovirus GII.2. The sensitivity analysis of RT-RPA-Cas12a-LFS with various concentrations of standard RNA was assessed using gel electrophoresis (a) and LFS (b). In the context of LFS, T denotes the testing line, while C represents the quality control line.
The sensitivity analysis of RT-RPA-Cas12a-LFS for detection of norovirus GII.2. The sensitivity analysis of RT-RPA-Cas12a-LFS with various concentrations of standard RNA was assessed using gel electrophoresis (a) and LFS (b). In the context of LFS, T denotes the testing line, while C represents the quality control line.

Fig. 6.

The specificity and sensitivity analysis of qRT-PCR for detection of norovirus GII.2. The specificity analysis of qRT-PCR was conducted with various viral genome samples (a), while the sensitivity analysis of qRT-PCR was performed with different concentrations of standard RNA (b), and the results were evaluated based on the fluorescence curve. NoV – norovirus GII.2 subtype, RV – human rotavirus, AdV – adenovirus, AstV – astrovirus, CV – coxsackievirus, SaV – sapovirus, BoV – bocavirus, NC – ddH2O.
The specificity and sensitivity analysis of qRT-PCR for detection of norovirus GII.2. The specificity analysis of qRT-PCR was conducted with various viral genome samples (a), while the sensitivity analysis of qRT-PCR was performed with different concentrations of standard RNA (b), and the results were evaluated based on the fluorescence curve. NoV – norovirus GII.2 subtype, RV – human rotavirus, AdV – adenovirus, AstV – astrovirus, CV – coxsackievirus, SaV – sapovirus, BoV – bocavirus, NC – ddH2O.

Fig. 7.

The performance analysis of RT-RPA-Cas12a-LFS for detecting norovirus GII.2, compared with qRT-PCR, was evaluated using simulated clinical samples. 30 representative results out of 60 samples are displayed.
The performance analysis of RT-RPA-Cas12a-LFS for detecting norovirus GII.2, compared with qRT-PCR, was evaluated using simulated clinical samples. 30 representative results out of 60 samples are displayed.

Statistical analysis of simulated samples using both the RT-RPA-Cas12a-LFS and qRT-PCR methods_

qRT-PCR CR
Positive Negative Total
RT-RPA-Cas12a-LFS Positive 38 0 38 98.33%
Negative 1 21 22
Total 39 21 60

The oligonucleotide sequences for the primer, crRNA, and ssDNA reporter_

Name Sequence (5’-3’) NoV-GII.2-F1 AGGTGCYAATGCAATAAATCAGAGGGCAGA
NoV-GII.2-F2 CAATGGGCTYAGTTCAYTRATYAATGCAGG
NoV-GII.2-R1 CACCTCTGGCTGCATCAGCRGGGGAAAAGC
NoV-GII.2-R2 TGTTTTATAGCCATCATRTCTGCCTGCAGC
Pre-NoV-GII.2-crRNA-F GAAATTAATACGACTCACTATAGGGTAATTTCTACTAAGTGTAGATAATCATGATAAGGAGATGTT
Pre-NoV-GII.2-crRNA-R AACATCTCCTTATCATGATTATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTAATTTC
ssDNA reporter 6-FAM-TTATTATT-Biotin
NoV-GII.2-qPCR-F GAGGGCAGAATTTGATTTTAATC
NoV-GII.2-qPCR-R CCTTGTTTTATAGCCATCATG
NoV-GII.2-qPCR-P FAM-TTGCCTGAATCTGAGCCTGC-BHQ1
Lingua:
Inglese
Frequenza di pubblicazione:
4 volte all'anno
Argomenti della rivista:
Scienze biologiche, Microbiologia e virologia
Feed RSS della rivista