Accès libre

Establishment of a Nucleic Acid Detection Method for Norovirus GII.2 Genotype Based on RT-RPA and CRISPR/Cas12a-LFS

Ting Wang
Ting Wang
, 
Hao Zeng
Hao Zeng
, 
Jie Kang
Jie Kang
, 
Lanlan Lei
Lanlan Lei
, 
Jing Liu
Jing Liu
, 
Yuhong Zheng
Yuhong Zheng
, 
Weidong Qian
Weidong Qian
 et 
Cheng Fan
Cheng Fan
   | 20 juin 2024
Polish Journal of Microbiology's Cover Image
À propos de cet article
Article précédent
Article suivant
Citez
Article Category: Original Paper
Publié en ligne: 20 juin 2024
Pages: 253 - 262
Reçu: 09 mars 2024
Accepté: 09 mai 2024
DOI: https://doi.org/10.33073/pjm-2024-023
Mots clés
© 2024 Ting Wang et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1.

Screening of the optimal primer pair for RT-RPA for detection of norovirus GII.2. a) The amplification efficiency of RT-RPA with various primer combinations was assessed using gel electrophoresis; b) the amplification efficiency of RT-RPA with various primer combinations was evaluated using LFS, driven by the cleavage activity mediated by the complex of Cas12a and the target amplified product. M – DL2000 marker; F1R1 – primer pairs of NoV-GII.2-F1/NoV-GII.2-R1; F1R2 – primer pairs of NoV-GII.2-F1/NoV-GII.2-R2; F2R1 – Primer pairs of NoV-GII.2-F2/NoV-GII.2-R1; F2R2 – primer pairs of NoV-GII.2-F2/NoV-GII.2-R2; F12R12 – primer pairs of NoV-GII.2-F1/NoV-GII.2-F2 and NoV-GII.2-R1/NoV-GII.2-R2; NC – negative control. In the context of LFS, T denotes the testing line, while C represents the quality control line.
Screening of the optimal primer pair for RT-RPA for detection of norovirus GII.2. a) The amplification efficiency of RT-RPA with various primer combinations was assessed using gel electrophoresis; b) the amplification efficiency of RT-RPA with various primer combinations was evaluated using LFS, driven by the cleavage activity mediated by the complex of Cas12a and the target amplified product. M – DL2000 marker; F1R1 – primer pairs of NoV-GII.2-F1/NoV-GII.2-R1; F1R2 – primer pairs of NoV-GII.2-F1/NoV-GII.2-R2; F2R1 – Primer pairs of NoV-GII.2-F2/NoV-GII.2-R1; F2R2 – primer pairs of NoV-GII.2-F2/NoV-GII.2-R2; F12R12 – primer pairs of NoV-GII.2-F1/NoV-GII.2-F2 and NoV-GII.2-R1/NoV-GII.2-R2; NC – negative control. In the context of LFS, T denotes the testing line, while C represents the quality control line.

Fig. 2.

Screening of the optimal concentration of the primer pair for RT-RPA-Cas12a-LFS to detect norovirus GII.2. a) The amplification efficiency of RT-RPA with different primer concentrations was examined using gel electrophoresis; b) the amplification efficiency of RT-RPA with various primer concentrations was assessed using LFS, facilitated by the cleavage activity mediated by the complex of Cas12a and the target amplified product. In the context of LFS, T denotes the testing line, while C represents the quality control line.
Screening of the optimal concentration of the primer pair for RT-RPA-Cas12a-LFS to detect norovirus GII.2. a) The amplification efficiency of RT-RPA with different primer concentrations was examined using gel electrophoresis; b) the amplification efficiency of RT-RPA with various primer concentrations was assessed using LFS, facilitated by the cleavage activity mediated by the complex of Cas12a and the target amplified product. In the context of LFS, T denotes the testing line, while C represents the quality control line.

Fig. 3.

Screening of the optimal reaction time of RT-RPA for RT-RPA-Cas12a-LFS to detect norovirus GII.2. a) The amplification efficiency of RT-RPA with different reaction times was determined using gel electrophoresis; b) The amplification efficiency of RT-RPA with different reaction times was analyzed using LFS, facilitated by the cleavage activity mediated by the complex of Cas12a and the target amplified product. In the context of LFS, T denotes the testing line, while C represents the quality control line.
Screening of the optimal reaction time of RT-RPA for RT-RPA-Cas12a-LFS to detect norovirus GII.2. a) The amplification efficiency of RT-RPA with different reaction times was determined using gel electrophoresis; b) The amplification efficiency of RT-RPA with different reaction times was analyzed using LFS, facilitated by the cleavage activity mediated by the complex of Cas12a and the target amplified product. In the context of LFS, T denotes the testing line, while C represents the quality control line.

Fig. 4.

The specificity analysis of RT-RPA-Cas12a-LFS with various viral genome samples was assessed using gel electrophoresis (a) and LFS (b). In the context of LFS, T denotes the testing line, while C represents the quality control line.
The specificity analysis of RT-RPA-Cas12a-LFS with various viral genome samples was assessed using gel electrophoresis (a) and LFS (b). In the context of LFS, T denotes the testing line, while C represents the quality control line.

Fig. 5.

The sensitivity analysis of RT-RPA-Cas12a-LFS for detection of norovirus GII.2. The sensitivity analysis of RT-RPA-Cas12a-LFS with various concentrations of standard RNA was assessed using gel electrophoresis (a) and LFS (b). In the context of LFS, T denotes the testing line, while C represents the quality control line.
The sensitivity analysis of RT-RPA-Cas12a-LFS for detection of norovirus GII.2. The sensitivity analysis of RT-RPA-Cas12a-LFS with various concentrations of standard RNA was assessed using gel electrophoresis (a) and LFS (b). In the context of LFS, T denotes the testing line, while C represents the quality control line.

Fig. 6.

The specificity and sensitivity analysis of qRT-PCR for detection of norovirus GII.2. The specificity analysis of qRT-PCR was conducted with various viral genome samples (a), while the sensitivity analysis of qRT-PCR was performed with different concentrations of standard RNA (b), and the results were evaluated based on the fluorescence curve. NoV – norovirus GII.2 subtype, RV – human rotavirus, AdV – adenovirus, AstV – astrovirus, CV – coxsackievirus, SaV – sapovirus, BoV – bocavirus, NC – ddH2O.
The specificity and sensitivity analysis of qRT-PCR for detection of norovirus GII.2. The specificity analysis of qRT-PCR was conducted with various viral genome samples (a), while the sensitivity analysis of qRT-PCR was performed with different concentrations of standard RNA (b), and the results were evaluated based on the fluorescence curve. NoV – norovirus GII.2 subtype, RV – human rotavirus, AdV – adenovirus, AstV – astrovirus, CV – coxsackievirus, SaV – sapovirus, BoV – bocavirus, NC – ddH2O.

Fig. 7.

The performance analysis of RT-RPA-Cas12a-LFS for detecting norovirus GII.2, compared with qRT-PCR, was evaluated using simulated clinical samples. 30 representative results out of 60 samples are displayed.
The performance analysis of RT-RPA-Cas12a-LFS for detecting norovirus GII.2, compared with qRT-PCR, was evaluated using simulated clinical samples. 30 representative results out of 60 samples are displayed.

Statistical analysis of simulated samples using both the RT-RPA-Cas12a-LFS and qRT-PCR methods.

qRT-PCR CR
Positive Negative Total
RT-RPA-Cas12a-LFS Positive 38 0 38 98.33%
Negative 1 21 22
Total 39 21 60

The oligonucleotide sequences for the primer, crRNA, and ssDNA reporter.

Name Sequence (5’-3’) NoV-GII.2-F1 AGGTGCYAATGCAATAAATCAGAGGGCAGA
NoV-GII.2-F2 CAATGGGCTYAGTTCAYTRATYAATGCAGG
NoV-GII.2-R1 CACCTCTGGCTGCATCAGCRGGGGAAAAGC
NoV-GII.2-R2 TGTTTTATAGCCATCATRTCTGCCTGCAGC
Pre-NoV-GII.2-crRNA-F GAAATTAATACGACTCACTATAGGGTAATTTCTACTAAGTGTAGATAATCATGATAAGGAGATGTT
Pre-NoV-GII.2-crRNA-R AACATCTCCTTATCATGATTATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTAATTTC
ssDNA reporter 6-FAM-TTATTATT-Biotin
NoV-GII.2-qPCR-F GAGGGCAGAATTTGATTTTAATC
NoV-GII.2-qPCR-R CCTTGTTTTATAGCCATCATG
NoV-GII.2-qPCR-P FAM-TTGCCTGAATCTGAGCCTGC-BHQ1
eISSN:
2544-4646
Langue:
Anglais
Périodicité:
4 fois par an
Sujets de la revue:
Life Sciences, Microbiology and Virology
RSS Feed de la revue