Accesso libero

Epidemiological Characteristics of Shiga Toxin-Producing Escherichia coli Responsible for Infections in the Polish Pediatric Population

Dominika Seliga-Gąsior

Dominika Seliga-Gąsior

Microbiological Laboratory, University Center for Laboratory Medicine, University Medical Center, Medical University of WarsawWarsaw, Poland
Profilo Orcid
Cerca questo autore su
Sciendo|Google Scholar
Seliga-Gąsior, Dominika
, 
Beata Sokól-Leszczyñska

Beata Sokól-Leszczyñska

  • Microbiological Laboratory, University Center for Laboratory Medicine, University Medical Center, Medical University of WarsawWarsaw, Poland
  • Department of Medical Microbiology, Medical University of WarsawWarsaw, Poland
Profilo Orcid
Cerca questo autore su
Sciendo|Google Scholar
Sokól-Leszczyñska, Beata
, 
Jolanta Krzysztoñ-Russjan

Jolanta Krzysztoñ-Russjan

Microbiological Laboratory, University Center for Laboratory Medicine, University Medical Center, Medical University of WarsawWarsaw, Poland
Profilo Orcid
Cerca questo autore su
Sciendo|Google Scholar
Krzysztoñ-Russjan, Jolanta
, 
Diana Wierzbicka

Diana Wierzbicka

Microbiological Laboratory, University Center for Laboratory Medicine, University Medical Center, Medical University of WarsawWarsaw, Poland
Profilo Orcid
Cerca questo autore su
Sciendo|Google Scholar
Wierzbicka, Diana
, 
Karolina Stępieñ-Hołubczat

Karolina Stępieñ-Hołubczat

Department of Microbiology and Pharmaceutical Bioanalysis, Medical University of WarsawWarsaw, Poland
Profilo Orcid
Cerca questo autore su
Sciendo|Google Scholar
Stępieñ-Hołubczat, Karolina
, 
Paulina Lewandowska

Paulina Lewandowska

Microbiological Laboratory, University Center for Laboratory Medicine, University Medical Center, Medical University of WarsawWarsaw, Poland
Profilo Orcid
Cerca questo autore su
Sciendo|Google Scholar
Lewandowska, Paulina
, 
Ewa Frankiewicz

Ewa Frankiewicz

Department of Medical Informatics and Telemedicine, Medical University of WarsawWarsaw, Poland
Profilo Orcid
Cerca questo autore su
Sciendo|Google Scholar
Frankiewicz, Ewa
, 
Andrzej Cacko

Andrzej Cacko

Department of Medical Informatics and Telemedicine, Medical University of WarsawWarsaw, Poland
Profilo Orcid
Cerca questo autore su
Sciendo|Google Scholar
Cacko, Andrzej
, 
Beata Leszczyñska

Beata Leszczyñska

Department of Pediatrics and Nephrology, Medical University of WarsawWarsaw, Poland
Profilo Orcid
Cerca questo autore su
Sciendo|Google Scholar
Leszczyñska, Beata
, 
Urszula Demkow

Urszula Demkow

Department of Laboratory Medicine and Clinical Immunology of Developmental Age, Medical University of WarsawWarsaw, Poland
Profilo Orcid
Cerca questo autore su
Sciendo|Google Scholar
Demkow, Urszula
 e 
Edyta Podsiadły

Edyta Podsiadły

  • Microbiological Laboratory, University Center for Laboratory Medicine, University Medical Center, Medical University of WarsawWarsaw, Poland
  • Department of Dental Microbiology, Medical University of WarsawWarsaw, Poland
Profilo Orcid
Cerca questo autore su
Sciendo|Google Scholar
Podsiadły, Edyta
  
10 mag 2024
Epidemiological Characteristics of Shiga Toxin-Producing Escherichia coli Responsible for Infections in the Polish Pediatric Population's Cover Image
INFORMAZIONI SU QUESTO ARTICOLO
Articolo precedente
Articolo Successivo
Cita
Scarica la copertina
Categoria dell'articolo: Original Paper
Pubblicato online: 10 mag 2024
Pagine: 177 - 187
DOI: https://doi.org/10.33073/pjm-2024-016
Parole chiave
© 2024 Dominika Seliga-Gąsior et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1.

Antibiotic susceptibility of STEC isolates (n = 33). AMC – amoxicillin/clavulanic acid, TZP – piperacillin/tazobactam, CTX – cefotaxime, CXM – cefuroxime, CAZ – ceftazidime, FEP – cefepime, IPM – imipenem, MEM – meropenem, AK – amikacin, CN – gentamicin, TOB – tobramycin, CIP – ciprofloxacin, SXT – trimethoprim/sulfamethoxazole, AZT – azithromycin.
Antibiotic susceptibility of STEC isolates (n = 33). AMC – amoxicillin/clavulanic acid, TZP – piperacillin/tazobactam, CTX – cefotaxime, CXM – cefuroxime, CAZ – ceftazidime, FEP – cefepime, IPM – imipenem, MEM – meropenem, AK – amikacin, CN – gentamicin, TOB – tobramycin, CIP – ciprofloxacin, SXT – trimethoprim/sulfamethoxazole, AZT – azithromycin.

Fig. 2.

Percentage of STEC isolates by month, 2018–2022 (n = 45).
Percentage of STEC isolates by month, 2018–2022 (n = 45).

Fig. 3.

PFGE patterns of selected Escherichia coli isolates. Original designations of the isolates and their PFGE types are shown above the corresponding lanes. Salmonella Branderup and γ ladder (New England Biolabs, USA) were used as PFGE molecular weight markers. Results of the analysis of genetic relatedness of STEC strains, 2018-2022.
PFGE patterns of selected Escherichia coli isolates. Original designations of the isolates and their PFGE types are shown above the corresponding lanes. Salmonella Branderup and γ ladder (New England Biolabs, USA) were used as PFGE molecular weight markers. Results of the analysis of genetic relatedness of STEC strains, 2018-2022.

Characteristics of primers and probes used in the study_

Gene name GenBank Access No. Nucleotide sequences (5’→3’)* Amplicon size (bp)
sxt1 M16625 Fw**: TTTGTYACTGTSACAGCWGAAGCYTTACG 132
Rv**: CCCCAGTTCARWGTRAGRTCMACRTC
Probe: CTGGATGATCTCAGTGGGCGTTCTTATGTAA
sxt2 X07865 Fw: TTTGTYACTGTSACAGCWGAAGCYTTACG 128
Rv: CCCCAGTTCARWGTRAGRTCMACRTC
Probe: TCGTCAGGCACTGTCTGAAACTGCTCC
uh Z11541 Fw: CATTGATCAGGATTTTTCTGGTGATA 102
Rv: CTCATGCGGAAATAGCCGTTA
Poll: ATAGTCTCGCCAGTATTCGCCACCAATACC

Characteristics of patients infected with STEC as diagnosed in the Medical Center of the Medical University of Warsaw, 2018–2022_

Characteristic of STEC patients Value (No.)
Boys 26
Girls 19
Median age (range) 2 years 8 months (1 month–16 years and 6 months)
Clinical manifestation Value (No.)
HUS 20
Only diarrhea 4
No data 21
Laboratory results No. cases/No. total
Direct positive PCR for stx1 and/or -2 from stool 45/45
Positive culture of STEC 44/45
PCR gene detection results No. cases/No. total
stx11 positive, stx22 negative 3/45
stx1 negative, stx2 positive 38/45
stx1 positive, stx2 positive 3/45
stx – unknown stx type 1/45
eaeA3 44/45
Serotypes No. total
O157 40
other than O157 1

Molecular characteristic of selected isolates derived from gastrointestinal infections_

PFGE type/subtype No. of isolates (Total No. 24) stx1, stx2 gene presence Voivodeship
B1, D, E, F, G, I, J, M, N, O, Q 11 stx2 Podlaskie
A1, A2, B2, C1, C2, H, K 8 stx2 Mazovian
Citrobacter freundii (no PFGE type) 1 stx1 Mazovian
C1, P, R 3 stx2 Warmian-Masurian
L 1 stx2 Greater Poland
Lingua:
Inglese
Frequenza di pubblicazione:
4 volte all'anno
Argomenti della rivista:
Scienze biologiche, Microbiologia e virologia
Feed RSS della rivista