INFORMAZIONI SU QUESTO ARTICOLO

Cita

Fig. 1.

Effect of intracerebroventricular injection of anandamide (AEA) indomethacin (IND) and AEA + IND on the expression of the gonadotropin-releasing hormone (GnRH) gene in the preoptic area (POA – A) and median eminence (ME – B) of anoestrous ewes. Data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.05)
Effect of intracerebroventricular injection of anandamide (AEA) indomethacin (IND) and AEA + IND on the expression of the gonadotropin-releasing hormone (GnRH) gene in the preoptic area (POA – A) and median eminence (ME – B) of anoestrous ewes. Data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.05)

Fig. 2.

Effect of intracerebroventricular injection of anandamide (AEA) indomethacin (IND) and AEA + IND on the gene expression of gonadotropin-releasing hormone receptor (GnRHR) in the median eminence (ME – A) and in the anterior pituitary (AP – B) of anoestrous ewes. The data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.05)
Effect of intracerebroventricular injection of anandamide (AEA) indomethacin (IND) and AEA + IND on the gene expression of gonadotropin-releasing hormone receptor (GnRHR) in the median eminence (ME – A) and in the anterior pituitary (AP – B) of anoestrous ewes. The data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.05)

Fig. 3.

Effect of intracerebroventricular injection of anandamide (AEA) indomethacin (IND) and AEA + IND on the content of gonadotropin-releasing hormone (GnRH) in the preoptic area (POA – A) and median eminence (ME – B) of anoestrous ewes. The data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.01)
Effect of intracerebroventricular injection of anandamide (AEA) indomethacin (IND) and AEA + IND on the content of gonadotropin-releasing hormone (GnRH) in the preoptic area (POA – A) and median eminence (ME – B) of anoestrous ewes. The data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.01)

Fig. 4.

Effect of intracerebroventricular injection of anandamide (AEA), indomethacin (IND) and AEA + IND on the plasma concentration of luteinising hormone (LH –A) and on the expression of the LHβ gene (B) in the anterior pituitary (AP) of anoestrous ewes. The data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.05)
Effect of intracerebroventricular injection of anandamide (AEA), indomethacin (IND) and AEA + IND on the plasma concentration of luteinising hormone (LH –A) and on the expression of the LHβ gene (B) in the anterior pituitary (AP) of anoestrous ewes. The data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.05)

Specific primers used in real-time PCR for determining the expression of housekeeping genes and genes of interest

GenBank accession No. Gene Amplicon size (base pairs) Forward/reverse Sequence 5’→3’ Reference
Housekeeping genes NM_001034034 GAPDHglyceraldehyde-3-phosphate dehydrogenase 134 forward AGAAGGCTGGGGCTCACT (31)
reverse GGCATTGCTGACAATCTTGA
U39357 ACTBβ-actin 168 forward CTTCCTTCCTGGGCATGG
reverse GGGCAGTGATCTCTTTCTGC
BC108088.1 HDAC1histone deacetylase1 115 forward CTGGGGACCTACGGGATATT
reverse GACATGACCGGCTTGAAAAT
Genes of interest NM_001009397 GnRHRgonadotropin-releasing hormone receptor 150 forward TCTTTGCTGGACCACAGTTAT (14)
reverse GGCAGCTGAAGGTGAAAAAG
U02517 GnRHgonadotropin-releasing hormone 123 forward GCCCTGGAGGAAAGAGAAAT
reverse GAGGAGAATGGGACTGGTGA
X52488 LHBluteinising hormone β-subunit 184 forward AGATGCTCCAGGGACTGCT
reverse TGCTTCATGCTGAGGCAGTA
eISSN:
2450-8608
Lingua:
Inglese
Frequenza di pubblicazione:
4 volte all'anno
Argomenti della rivista:
Life Sciences, Molecular Biology, other, Microbiology and Virology, Medicine, Veterinary Medicine