Accès libre

Effect of central administration of indomethacin on anandamide-induced GnRH/LH secretion in the hypothalamus of anoestrous ewes

Dorota Tomaszewska-Zaremba

Dorota Tomaszewska-Zaremba

Department of Animal Physiology, The Kielanowski Institute of Animal Physiology and Nutrition, Polish Academy of SciencesJabłonna, Poland
Profil Orcid
Recherchez cet auteur sur
Sciendo|Google Scholar
Tomaszewska-Zaremba, Dorota
, 
Monika Tomczyk

Monika Tomczyk

Department of Genetic Engineering, The Kielanowski Institute of Animal Physiology and Nutrition, Polish Academy of SciencesJabłonna, Poland
Profil Orcid
Recherchez cet auteur sur
Sciendo|Google Scholar
Tomczyk, Monika
, 
Karolina Wojtulewicz

Karolina Wojtulewicz

Department of Genetic Engineering, The Kielanowski Institute of Animal Physiology and Nutrition, Polish Academy of SciencesJabłonna, Poland
Profil Orcid
Recherchez cet auteur sur
Sciendo|Google Scholar
Wojtulewicz, Karolina
, 
Joanna Bochenek

Joanna Bochenek

Department of Genetic Engineering, The Kielanowski Institute of Animal Physiology and Nutrition, Polish Academy of SciencesJabłonna, Poland
Profil Orcid
Recherchez cet auteur sur
Sciendo|Google Scholar
Bochenek, Joanna
, 
Kinga Pałatyńska

Kinga Pałatyńska

Department of Animal Physiology, The Kielanowski Institute of Animal Physiology and Nutrition, Polish Academy of SciencesJabłonna, Poland
Profil Orcid
Recherchez cet auteur sur
Sciendo|Google Scholar
Pałatyńska, Kinga
 et 
Andrzej Przemysław Herman

Andrzej Przemysław Herman

Department of Genetic Engineering, The Kielanowski Institute of Animal Physiology and Nutrition, Polish Academy of SciencesJabłonna, Poland
Profil Orcid
Recherchez cet auteur sur
Sciendo|Google Scholar
Herman, Andrzej Przemysław
  
25 juil. 2024
Effect of central administration of indomethacin on anandamide-induced GnRH/LH secretion in the hypothalamus of anoestrous ewes's Cover Image
À propos de cet article
Article précédent
Article suivant
Citez
Télécharger la couverture
Publié en ligne: 25 juil. 2024
Pages: 451 - 459
Reçu: 29 déc. 2023
Accepté: 15 juil. 2024
DOI: https://doi.org/10.2478/jvetres-2024-0039
Mots clés
© 2024 Dorota Tomaszewska-Zaremba et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1.

Effect of intracerebroventricular injection of anandamide (AEA) indomethacin (IND) and AEA + IND on the expression of the gonadotropin-releasing hormone (GnRH) gene in the preoptic area (POA – A) and median eminence (ME – B) of anoestrous ewes. Data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.05)
Effect of intracerebroventricular injection of anandamide (AEA) indomethacin (IND) and AEA + IND on the expression of the gonadotropin-releasing hormone (GnRH) gene in the preoptic area (POA – A) and median eminence (ME – B) of anoestrous ewes. Data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.05)

Fig. 2.

Effect of intracerebroventricular injection of anandamide (AEA) indomethacin (IND) and AEA + IND on the gene expression of gonadotropin-releasing hormone receptor (GnRHR) in the median eminence (ME – A) and in the anterior pituitary (AP – B) of anoestrous ewes. The data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.05)
Effect of intracerebroventricular injection of anandamide (AEA) indomethacin (IND) and AEA + IND on the gene expression of gonadotropin-releasing hormone receptor (GnRHR) in the median eminence (ME – A) and in the anterior pituitary (AP – B) of anoestrous ewes. The data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.05)

Fig. 3.

Effect of intracerebroventricular injection of anandamide (AEA) indomethacin (IND) and AEA + IND on the content of gonadotropin-releasing hormone (GnRH) in the preoptic area (POA – A) and median eminence (ME – B) of anoestrous ewes. The data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.01)
Effect of intracerebroventricular injection of anandamide (AEA) indomethacin (IND) and AEA + IND on the content of gonadotropin-releasing hormone (GnRH) in the preoptic area (POA – A) and median eminence (ME – B) of anoestrous ewes. The data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.01)

Fig. 4.

Effect of intracerebroventricular injection of anandamide (AEA), indomethacin (IND) and AEA + IND on the plasma concentration of luteinising hormone (LH –A) and on the expression of the LHβ gene (B) in the anterior pituitary (AP) of anoestrous ewes. The data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.05)
Effect of intracerebroventricular injection of anandamide (AEA), indomethacin (IND) and AEA + IND on the plasma concentration of luteinising hormone (LH –A) and on the expression of the LHβ gene (B) in the anterior pituitary (AP) of anoestrous ewes. The data are presented as the mean ± standard error of the mean. The results were analysed using two-way analysis of variance with a post-hoc Fisher’s least significance test (P-value ≤ 0.05)

Specific primers used in real-time PCR for determining the expression of housekeeping genes and genes of interest

GenBank accession No. Gene Amplicon size (base pairs) Forward/reverse Sequence 5’→3’ Reference
Housekeeping genes NM_001034034 GAPDHglyceraldehyde-3-phosphate dehydrogenase 134 forward AGAAGGCTGGGGCTCACT (31)
reverse GGCATTGCTGACAATCTTGA
U39357 ACTBβ-actin 168 forward CTTCCTTCCTGGGCATGG
reverse GGGCAGTGATCTCTTTCTGC
BC108088.1 HDAC1histone deacetylase1 115 forward CTGGGGACCTACGGGATATT
reverse GACATGACCGGCTTGAAAAT
Genes of interest NM_001009397 GnRHRgonadotropin-releasing hormone receptor 150 forward TCTTTGCTGGACCACAGTTAT (14)
reverse GGCAGCTGAAGGTGAAAAAG
U02517 GnRHgonadotropin-releasing hormone 123 forward GCCCTGGAGGAAAGAGAAAT
reverse GAGGAGAATGGGACTGGTGA
X52488 LHBluteinising hormone β-subunit 184 forward AGATGCTCCAGGGACTGCT
reverse TGCTTCATGCTGAGGCAGTA
Langue:
Anglais
Périodicité:
4 fois par an
Sujets de la revue:
Sciences de la vie, Biologie moléculaire, Microbiologie et virologie, Sciences de la vie, autres, Médecine, Médecine vétérinaire
RSS Feed de la revue