INFORMAZIONI SU QUESTO ARTICOLO

Cita

Fig. 1.

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on malondialdehyde (MDA) in hepatocytes at different time points
* – significant MDA concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)
Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on malondialdehyde (MDA) in hepatocytes at different time points * – significant MDA concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Fig. 2.

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on catalase (CAT) in hepatocytes at different time points
* – significant CAT concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value <0.05) at the same time point; ** – highly significant difference (P-value <0.01)
Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on catalase (CAT) in hepatocytes at different time points * – significant CAT concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value <0.05) at the same time point; ** – highly significant difference (P-value <0.01)

Fig. 3.

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on glutathione peroxidase (GSH-Px) in hepatocytes at different time points
* –significant GSH-Px concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)
Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on glutathione peroxidase (GSH-Px) in hepatocytes at different time points * –significant GSH-Px concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Fig. 4.

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on superoxide dismutase (SOD) in hepatocytes at different time points
* – significant SOD concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)
Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on superoxide dismutase (SOD) in hepatocytes at different time points * – significant SOD concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Fig. 5.

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the gene expression level of catalase (CAT) messenger RNA (mRNA) in hepatocytes at different time points
* – significant CAT expression difference between BHBA concentration groups and the 0.0 mmol L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)
Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the gene expression level of catalase (CAT) messenger RNA (mRNA) in hepatocytes at different time points * – significant CAT expression difference between BHBA concentration groups and the 0.0 mmol L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Fig. 6.

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of glutathione peroxidase (GSH-Px) messenger RNA (mRNA) in hepatocytes at different time points
* – significant GSH-Px expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)
Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of glutathione peroxidase (GSH-Px) messenger RNA (mRNA) in hepatocytes at different time points * – significant GSH-Px expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Fig. 7.

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of superoxide dismutase (SOD) messenger RNA (mRNA) in hepatocytes at different time points
* – significant SOD expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)
Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of superoxide dismutase (SOD) messenger RNA (mRNA) in hepatocytes at different time points * – significant SOD expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Fig. 8.

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of growth hormone receptor (GHR) messenger RNA (mRNA) in hepatocytes at different time points
* – significant GHR expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)
Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of growth hormone receptor (GHR) messenger RNA (mRNA) in hepatocytes at different time points * – significant GHR expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Fig. 9.

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of insulin-like growth factor (IGF) messenger RNA (mRNA) in hepatocytes at different time points
* – significant IGF expression difference between BHBA concentration groups and the 0.0 mmol L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)
Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of insulin-like growth factor (IGF) messenger RNA (mRNA) in hepatocytes at different time points * – significant IGF expression difference between BHBA concentration groups and the 0.0 mmol L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Fig. 10.

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of insulin-like growth factor 1 receptor (IGF-1R) messenger RNA (mRNA) in hepatocytes at different time points
* – significant IGF-1R expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P value < 0.05) at the same time point; ** – highly significant difference (P-value <0.01)
Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of insulin-like growth factor 1 receptor (IGF-1R) messenger RNA (mRNA) in hepatocytes at different time points * – significant IGF-1R expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P value < 0.05) at the same time point; ** – highly significant difference (P-value <0.01)

Primer sequences utilised in a reverse-transcriptase-PCR

Gene GenBank accession No. Primer sequences (5′–3′) Base pairs
GSH-Px NM_001101113.2 Fwd GCGGGAGCAGGACTTCTACGARev CCCGATAGTGCTGGTCTGTGAA 137
SOD NM_201527.2 Fwd TTCAATAAGGAGCAGGGACGRev CAGTGTAAGGCTGACGGTTT 234
CAT NM_001035386.1 Fwd AGATACTCCAAGGCGAAGGTGRev AAAGCCACGAGGGTCACGAAC 120
IGF-1 NM_001077828.1 Fwd TCGCATCTCTTCTATCTGGCCCTGTRev GCAGTACATCTCCAGCCTCCTCAGA 101
IGF-1R NM_001244612.1 Fwd TTAAAATGGCCAGAACCTGAGRev ATTATAACCAAGCCTCCCAC 240
GHR NM_176608.1 Fwd CCAGTTTCCATGGTTCTTAATTATRev TTCCTTTAATCTTTGGAACTGG 138
β-actin NM_173979.3 Fwd CTCTTCCAGCCTTCCTTCCTRev GGGCAGTGATCTCTTTCTGC 233

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the oxidase index of hepatocytes in vitro

SOD (U·mL−1) CAT (U·mL−1) MDA (mmol·mL−1) GSH-Px (U·mL−1)
0.0 7.43 ± 0.44a 13.15 ± 0.48a 11.94 ± 0.35b 1.65 ± 0.05a
0.6 5.77 ± 0.69a 12.44 ± 0.50a 12.19 ± 0.32a 1.52 ± 0.06a
1.2 4.02 ± 0.73b 11.64 ± 0.72a 12.86 ± 0.38a 1.37 ± 0.08b
3.0 3.87 ± 0.84b 9.15 ± 1.06b 13.16 ± 0.38a 1.39 ± 0.06b
eISSN:
2450-8608
Lingua:
Inglese
Frequenza di pubblicazione:
4 volte all'anno
Argomenti della rivista:
Life Sciences, Molecular Biology, other, Microbiology and Virology, Medicine, Veterinary Medicine