Effect of β-hydroxybutyrate acid on gene expression levels of antioxidant biomarkers and growth hormone–related genes in liver cell culture

Mohsin, Muhammad Ali; Zhou, Xiaojing; Huiru, Yu; Shen, Wenxiang; He, Baoxiang; Sobiech, Przemysław; Pierzchała, Mariusz; Ogłuszka, Magdalena; Starzyński, Rafał; Kalra, Garima; Deshmukh, Bharti; Thangarasu, Revathy; Kashyap, Neeraj; Czarnik, Urszula; Lepczyński, Adam; Woźniakowski, Grzegorz; Pareek, Chandra S.

Acceso abierto

Effect of β-hydroxybutyrate acid on gene expression levels of antioxidant biomarkers and growth hormone–related genes in liver cell culture

,

,

,

,

,

,

,

,

,

,

,

,

,

,

,

Grzegorz Woźniakowski

Woźniakowski, Grzegorz

y

Chandra S. Pareek

Pareek, Chandra S.

22 jun 2024

Effect of β-hydroxybutyrate acid on gene expression levels of antioxidant biomarkers and growth hormone–related genes in liver cell culture's Cover Image

Journal of Veterinary Research

Volumen 68 (2024): Edición 2 (Junio 2024)

Acerca de este artículo

Artículo anterior

Artículo siguiente

Cite

Descargar portada

Publicado en línea: 22 jun 2024

Páginas: 313 - 324

Recibido: 01 nov 2023

Aceptado: 17 jun 2024

DOI: https://doi.org/10.2478/jvetres-2024-0037

Palabras clave
enzymatic antioxidant, β-hydroxybutyric acid, growth hormone, biomarkers, hepatocytes

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on malondialdehyde (MDA) in hepatocytes at different time points
* – significant MDA concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01) — Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on malondialdehyde (MDA) in hepatocytes at different time points * – significant MDA concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on catalase (CAT) in hepatocytes at different time points
* – significant CAT concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value <0.05) at the same time point; ** – highly significant difference (P-value <0.01) — Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on catalase (CAT) in hepatocytes at different time points * – significant CAT concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value <0.05) at the same time point; ** – highly significant difference (P-value <0.01)

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on glutathione peroxidase (GSH-Px) in hepatocytes at different time points
* –significant GSH-Px concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01) — Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on glutathione peroxidase (GSH-Px) in hepatocytes at different time points * –significant GSH-Px concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on superoxide dismutase (SOD) in hepatocytes at different time points
* – significant SOD concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01) — Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on superoxide dismutase (SOD) in hepatocytes at different time points * – significant SOD concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the gene expression level of catalase (CAT) messenger RNA (mRNA) in hepatocytes at different time points
* – significant CAT expression difference between BHBA concentration groups and the 0.0 mmol L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01) — Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the gene expression level of catalase (CAT) messenger RNA (mRNA) in hepatocytes at different time points * – significant CAT expression difference between BHBA concentration groups and the 0.0 mmol L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of glutathione peroxidase (GSH-Px) messenger RNA (mRNA) in hepatocytes at different time points
* – significant GSH-Px expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01) — Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of glutathione peroxidase (GSH-Px) messenger RNA (mRNA) in hepatocytes at different time points * – significant GSH-Px expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of superoxide dismutase (SOD) messenger RNA (mRNA) in hepatocytes at different time points
* – significant SOD expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01) — Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of superoxide dismutase (SOD) messenger RNA (mRNA) in hepatocytes at different time points * – significant SOD expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of growth hormone receptor (GHR) messenger RNA (mRNA) in hepatocytes at different time points
* – significant GHR expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01) — Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of growth hormone receptor (GHR) messenger RNA (mRNA) in hepatocytes at different time points * – significant GHR expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of insulin-like growth factor (IGF) messenger RNA (mRNA) in hepatocytes at different time points
* – significant IGF expression difference between BHBA concentration groups and the 0.0 mmol L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01) — Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of insulin-like growth factor (IGF) messenger RNA (mRNA) in hepatocytes at different time points * – significant IGF expression difference between BHBA concentration groups and the 0.0 mmol L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of insulin-like growth factor 1 receptor (IGF-1R) messenger RNA (mRNA) in hepatocytes at different time points
* – significant IGF-1R expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P value < 0.05) at the same time point; ** – highly significant difference (P-value <0.01) — Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of insulin-like growth factor 1 receptor (IGF-1R) messenger RNA (mRNA) in hepatocytes at different time points * – significant IGF-1R expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P value < 0.05) at the same time point; ** – highly significant difference (P-value <0.01)

Primer sequences utilised in a reverse-transcriptase-PCR

Gene	GenBank accession No.	Primer sequences (5′–3′)	Base pairs
GSH-Px	NM_001101113.2	Fwd GCGGGAGCAGGACTTCTACGARev CCCGATAGTGCTGGTCTGTGAA	137
SOD	NM_201527.2	Fwd TTCAATAAGGAGCAGGGACGRev CAGTGTAAGGCTGACGGTTT	234
CAT	NM_001035386.1	Fwd AGATACTCCAAGGCGAAGGTGRev AAAGCCACGAGGGTCACGAAC	120
IGF-1	NM_001077828.1	Fwd TCGCATCTCTTCTATCTGGCCCTGTRev GCAGTACATCTCCAGCCTCCTCAGA	101
IGF-1R	NM_001244612.1	Fwd TTAAAATGGCCAGAACCTGAGRev ATTATAACCAAGCCTCCCAC	240
GHR	NM_176608.1	Fwd CCAGTTTCCATGGTTCTTAATTATRev TTCCTTTAATCTTTGGAACTGG	138
β-actin	NM_173979.3	Fwd CTCTTCCAGCCTTCCTTCCTRev GGGCAGTGATCTCTTTCTGC	233

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the oxidase index of hepatocytes in vitro

	SOD (U·mL⁻¹)	CAT (U·mL⁻¹)	MDA (mmol·mL⁻¹)	GSH-Px (U·mL⁻¹)
0.0	7.43 ± 0.44^a	13.15 ± 0.48^a	11.94 ± 0.35^b	1.65 ± 0.05^a
0.6	5.77 ± 0.69^a	12.44 ± 0.50^a	12.19 ± 0.32^a	1.52 ± 0.06^a
1.2	4.02 ± 0.73^b	11.64 ± 0.72^a	12.86 ± 0.38^a	1.37 ± 0.08^b
3.0	3.87 ± 0.84^b	9.15 ± 1.06^b	13.16 ± 0.38^a	1.39 ± 0.06^b

Idioma:: Inglés

Calendario de la edición:: 4 veces al año
Temas de la revista:: Ciencias de la vida, Biología molecular, Microbiología y virología, Ciencias de la vida, otros, Medicina, Medicina veterinaria

RSS Feed de revista

Effect of β-hydroxybutyrate acid on gene expression levels of antioxidant biomarkers and growth hormone–related genes in liver cell culture

Publicado en línea: 22 jun 2024

Páginas: 313 - 324

Recibido: 01 nov 2023

Aceptado: 17 jun 2024

DOI: https://doi.org/10.2478/jvetres-2024-0037

Palabras clave
enzymatic antioxidant, β-hydroxybutyric acid, growth hormone, biomarkers, hepatocytes

© 2024 Muhammad Ali Mohsin et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1.

Fig. 2.

Fig. 3.

Fig. 4.

Fig. 5.

Fig. 6.

Fig. 7.

Fig. 8.

Fig. 9.

Fig. 10.

Primer sequences utilised in a reverse-transcriptase-PCR

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the oxidase index of hepatocytes in vitro

Effect of β-hydroxybutyrate acid on gene expression levels of antioxidant biomarkers and growth hormone–related genes in liver cell culture

Muhammad Ali Mohsin

Xiaojing Zhou

Yu Huiru

Wenxiang Shen

Baoxiang He

Przemysław Sobiech

Mariusz Pierzchała

Magdalena Ogłuszka

Rafał Starzyński

Garima Kalra

Bharti Deshmukh

Revathy Thangarasu

Neeraj Kashyap

Urszula Czarnik

Adam Lepczyński

Grzegorz Woźniakowski

Chandra S. Pareek

Publicado en línea: 22 jun 2024

Páginas: 313 - 324

Recibido: 01 nov 2023

Aceptado: 17 jun 2024

DOI: https://doi.org/10.2478/jvetres-2024-0037

Palabras claveenzymatic antioxidant, β-hydroxybutyric acid, growth hormone, biomarkers, hepatocytes

© 2024 Muhammad Ali Mohsin et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1.

Fig. 2.

Fig. 3.

Fig. 4.

Fig. 5.

Fig. 6.

Fig. 7.

Fig. 8.

Fig. 9.

Fig. 10.

Primer sequences utilised in a reverse-transcriptase-PCR

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the oxidase index of hepatocytes in vitro

Palabras clave
enzymatic antioxidant, β-hydroxybutyric acid, growth hormone, biomarkers, hepatocytes