Accesso libero

Investigation of the prevalence of Mycoplasma ovipneumoniae in Southern Xinjiang, China

Jin-yu Zhao
Jin-yu Zhao
, 
Yi-zhou Du
Yi-zhou Du
, 
Ya-ping Song
Ya-ping Song
, 
Peng Zhou
Peng Zhou
, 
Yue-feng Chu
Yue-feng Chu
 e 
Jun-yuan Wu
Jun-yuan Wu
   | 23 apr 2021
Journal of Veterinary Research's Cover Image
INFORMAZIONI SU QUESTO ARTICOLO
Articolo precedente
Articolo Successivo
Cita
Pubblicato online: 23 apr 2021
Pagine: 155 - 160
Ricevuto: 14 set 2020
Accettato: 26 mar 2021
DOI: https://doi.org/10.2478/jvetres-2021-0021
Parole chiave
© 2021 J.Y. Zhao et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Pathological changes in the lungs of sheep with suspected M. ovipneumoniae infection. A - caseous transformation; B - lung surface consolidation
Pathological changes in the lungs of sheep with suspected M. ovipneumoniae infection. A - caseous transformation; B - lung surface consolidation

Fig. 2

Morphological identification of M. ovipneumoniae. Single colony of M. ovipneumoniae (C, 100×); multi-colony of M. ovipneumoniae (D, 40×)
Morphological identification of M. ovipneumoniae. Single colony of M. ovipneumoniae (C, 100×); multi-colony of M. ovipneumoniae (D, 40×)

Fig. 3

Detection of M. ovipneumoniae and Mycoplasma genus in samples from sheep by PCR. M - DNA marker DL-2000 (2000, 1000, 750, 500, 250, 100 bp); A - 1–20 M. ovipneumoniae positive samples; B - 1–20 Mycoplasma genus positive samples
Detection of M. ovipneumoniae and Mycoplasma genus in samples from sheep by PCR. M - DNA marker DL-2000 (2000, 1000, 750, 500, 250, 100 bp); A - 1–20 M. ovipneumoniae positive samples; B - 1–20 Mycoplasma genus positive samples

Fig. 4

Phylogenetic tree of M. ovipneumoniae based on partial sequences of the M. ovipneumoniae 16S rRNA gene amplified with specific primers. The Mycoplasma 16S rRNA gene sequences were aligned using MEGA 6.0 software; 1000 bootstrap replicates were used to determine the nucleotide sequence distance. A consensus phylogenetic tree was created using the neighbour-joining method. The black boxes signify the M. ovipneumoniae strains XJ-AL-Mo-1, XJ-KC-Mo-1, XJ-MGT-Mo-99 and XJ-yjs-Mo-1 identified in this study. The white boxes signify M. ovipneumoniae strains isolated in northern Xinjiang (Chen et al., 2015). MoGH3-3, GZ-WN, FJ-SM, FJ-01MH are strains from inland China, and the black circle signifies the M. ovipneumoniae international standard strain Y-98
Phylogenetic tree of M. ovipneumoniae based on partial sequences of the M. ovipneumoniae 16S rRNA gene amplified with specific primers. The Mycoplasma 16S rRNA gene sequences were aligned using MEGA 6.0 software; 1000 bootstrap replicates were used to determine the nucleotide sequence distance. A consensus phylogenetic tree was created using the neighbour-joining method. The black boxes signify the M. ovipneumoniae strains XJ-AL-Mo-1, XJ-KC-Mo-1, XJ-MGT-Mo-99 and XJ-yjs-Mo-1 identified in this study. The white boxes signify M. ovipneumoniae strains isolated in northern Xinjiang (Chen et al., 2015). MoGH3-3, GZ-WN, FJ-SM, FJ-01MH are strains from inland China, and the black circle signifies the M. ovipneumoniae international standard strain Y-98

Primers used in this study

Species Primer name Primer sequence Annealing temperature Amplicon size (bp) Reference
Mycoplasma genus MGSO RNA5 TGCACCATCTGTCACTCTGTTAACCTC AGAGTTTGATCCTGGGCTCAGGA 58°C 1021 (21)
M. ovipneumoniae PP1 2 GACTTCATCCTGCACTCTGT TGAACGGAATATGTTAGCTT 55°C 361 (17)

M. ovipneumoniae PCR detection results in nasal swabs

Region Examined Positive Prevalence (%)
Hotan 200 76 38.00
Kashgar 242 128 52.89
Aksu 232 73 31.47
Bazhou 150 59 39.33
Total 824 336 40.78

M. ovipneumoniae positive rates in nasal swabs by animal age

Age (months) Examined Positive Prevalence (%)
Kazak Duolang Total Kazak Duolang Total Kazak Duolang Total
< 3 106 130 236 59 67 126 55.67 51.54 53.39
3-12 78 85 163 38 37 75 50.67 49.33 46.01
>12 201 224 425 60 75 135 29.85 33.48 31.76
Total 385 439 824 147 189 336 38.10 43.05 40.78
eISSN:
2450-8608
Lingua:
Inglese
Frequenza di pubblicazione:
4 volte all'anno
Argomenti della rivista:
Life Sciences, Molecular Biology, Microbiology and Virology, other, Medicine, Veterinary Medicine
Feed RSS della rivista