Investigation of the prevalence of Mycoplasma ovipneumoniae in Southern Xinjiang, China
, , , , et
23 avr. 2021
À propos de cet article
Publié en ligne: 23 avr. 2021
Pages: 155 - 160
Reçu: 14 sept. 2020
Accepté: 26 mars 2021
DOI: https://doi.org/10.2478/jvetres-2021-0021
Mots clés
© 2021 J.Y. Zhao et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.
Fig. 1

Fig. 2

Fig. 3

Fig. 4

Primers used in this study
Species | Primer name | Primer sequence | Annealing temperature | Amplicon size (bp) | Reference |
---|---|---|---|---|---|
MGSO |
TGCACCATCTGTCACTCTGTTAACCTC |
58°C | 1021 | (21) | |
PP1 |
GACTTCATCCTGCACTCTGT |
55°C | 361 | (17) |
M_ ovipneumoniae PCR detection results in nasal swabs
Region | Examined | Positive | Prevalence (%) |
---|---|---|---|
Hotan | 200 | 76 | 38.00 |
Kashgar | 242 | 128 | 52.89 |
Aksu | 232 | 73 | 31.47 |
Bazhou | 150 | 59 | 39.33 |
Total | 824 | 336 | 40.78 |
M_ ovipneumoniae positive rates in nasal swabs by animal age
Age (months) | Examined | Positive | Prevalence (%) | ||||||
---|---|---|---|---|---|---|---|---|---|
Kazak | Duolang | Total | Kazak | Duolang | Total | Kazak | Duolang | Total | |
< 3 | 106 | 130 | 236 | 59 | 67 | 126 | 55.67 | 51.54 | 53.39 |
3-12 | 78 | 85 | 163 | 38 | 37 | 75 | 50.67 | 49.33 | 46.01 |
>12 | 201 | 224 | 425 | 60 | 75 | 135 | 29.85 | 33.48 | 31.76 |
Total | 385 | 439 | 824 | 147 | 189 | 336 | 38.10 | 43.05 | 40.78 |